or
or
Exact

Results for "TCHH"

Variant Events: 18

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
TCHH     SP0000607chr1:
152084291-152084291
CTexonicDe novononsynonymous SNVNM_007113c.G1402Ap.E468K5.5398.288E-6Feliciano2019 E
TCHH     1-0627-006chr1:
152096695-152096695
TGintergenicDe novo--Yuen2017 G
TCHH     1-0498-003chr1:
152107216-152107232
CAGAGAGAGAGAGAGAGCAGAGAGAGAGAGAGintergenicDe novo--Yuen2017 G
TCHH     14379.p1chr1:
152080982-152080982
GCexonicDe novononsynonymous SNVNM_007113c.C4711Gp.Q1571E9.998-Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
TCHH     2-1702-003chr1:
152078084-152078084
CTdownstreamDe novo--Yuen2017 G
TCHH     13601.p1chr1:
152082606-152082696
TTCCTGCTGCAGCTCGTCTTTTTTGCGGTACTGCCTCTCCCACTCCTGGCGCCTTCTCTTCTCCCGTTCCTCTCTCAGCAGCTGCTCTTCCTexonicDe novononframeshift deletionNM_007113c.2997_3086delp.999_1029del--Satterstrom2020 E
TCHH     iHART1291chr1:
152081684-152081688
TTCTGTexonicPaternalframeshift deletionNM_007113c.4005_4008delp.D1335fs-3.0E-4Ruzzo2019 G
TCHH     iHART2308chr1:
152080861-152080865
TGTTGTexonicMaternalframeshift deletionNM_007113c.4828_4831delp.Q1610fs-4.142E-5Ruzzo2019 G
TCHH     iHART1573chr1:
152084156-152084161
CCTCTTCexonicPaternalframeshift deletionNM_007113c.1532_1536delp.Q511fs-8.351E-6Ruzzo2019 G
TCHH     SP0011734chr1:
152082220-152082220
GTexonicDe novononsynonymous SNVNM_007113c.C3473Ap.P1158Q2.0751.661E-5Feliciano2019 E
TCHH     iHART1295chr1:
152081684-152081688
TTCTGTexonicPaternalframeshift deletionNM_007113c.4005_4008delp.D1335fs-3.0E-4Ruzzo2019 G
TCHH     2-1345-003chr1:
152110273-152110273
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
TCHH     AC04-0038-04_achr1:
152080947-152081181
ACGGAATTTTCTGTCACGCTCTTGGCGGCTCAGCTGCTGTTCCTCCCTCTCCTGGCGCAGCTGTTCCTCCTCGCGGAATTTTCTGTCACGGTCCTGACGCCGCTGTTGCCCGCGCTCCTGGCGGCGCAGCTGCTGTTCCTCCTGGAGGAATTTTCTCTGCCGTTGCTGGCGGTGCAGCTGCTGTTCCTCCTCGAGGAATTTTCTCTCTGGTTCCTGACTGCGCAGTTCCTGTTCGAexonicDe novononframeshift deletionNM_007113c.4512_4745delp.1504_1582del-5.798E-5Satterstrom2020 E
TCHH     SSC12226chr1:
152082500-152082500
CTexonicDe novononsynonymous SNVNM_007113c.G3193Ap.G1065R5.1196.0E-4Lim2017 E
TCHH     11417.p1chr1:
152082310-152082400
CGTTCCTCTCTCAGCAGCTGCTCTTCCTCCTGCTGCAGCTCCTCTTCCTCCCGACATTGCCTCTCCCGCTCCTGGCGCCTTCTCTTCTCCGCexonicDe novononframeshift deletionNM_007113c.3293_3382delp.1098_1128del-4.146E-5Satterstrom2020 E
TCHH     DEASD_1020_001chr1:
152080172-152080172
GAexonicDe novostopgainNM_007113c.C5521Tp.R1841X40.08.28E-6Satterstrom2020 E
TCHH     G01-GEA-312-HIchr1:
152082475-152082476
CGCexonicDe novoframeshift deletionNM_007113c.3217delCp.R1073fs--Satterstrom2020 E
TCHH     MT_160chr1:
152081724-152081724
CGexonicPaternalnonsynonymous SNVNM_007113c.G3969Cp.E1323D13.57-Toma2013 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More