or
or
Exact

Results for "SLC15A1"

Variant Events: 11

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SLC15A1     152-HSC0079chr13:
99361005-99361005
CGexonicInheritednonsynonymous SNVNM_005073c.G1084Cp.A362P14.111.0E-4Patowary2019 E
SLC15A1     AU2000304chr13:
99426496-99426496
CTintergenicDe novo--Yuen2017 G
SLC15A1     SP0009287chr13:
99354735-99354735
TCexonicDe novononsynonymous SNVNM_005073c.A1465Gp.R489G11.71-Feliciano2019 E
SLC15A1     11940.p1chr13:
99379122-99379146
AAAACAGAATCCCAATATTAAAGTCAintronicDe novo-2.0E-4Satterstrom2020 E
SLC15A1     iHART1908chr13:
99358483-99358483
CAexonicMaternalstopgainNM_005073c.G1174Tp.G392X23.0-Ruzzo2019 G
SLC15A1     AU4028302chr13:
99381763-99381763
AGintronicDe novo--Yuen2017 G
SLC15A1     AU024105chr13:
99369102-99369102
CTintronicDe novo--Yuen2017 G
SLC15A1     AU0786305chr13:
99390980-99390980
CTintronicDe novo--Yuen2017 G
SLC15A1     1-0906-003chr13:
99346119-99346129
GAGTCACACAAGAintronicDe novo--Yuen2017 G
SLC15A1     12693.p1chr13:
99360954-99360954
GTexonicMosaicnonsynonymous SNVNM_005073c.C1135Ap.Q379K20.7-Dou2017 E
SLC15A1     1-0526-003chr13:
99429012-99429012
AAGintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More