or
or
Exact

Results for "SLC28A3"

Variant Events: 30

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SLC28A3     1-0531-003chr9:
87120629-87120629
ACintergenicDe novo--Yuen2016 G
Yuen2017 G
SLC28A3     1-0571-003chr9:
87103681-87103681
GTintergenicDe novo--Yuen2017 G
SLC28A3     2-1646-003chr9:
87074111-87074116
TGAGAGTGAGintergenicDe novo--Yuen2017 G
SLC28A3     13946.p1chr9:
87117778-87117778
GTintergenicDe novo--Turner2016 G
SLC28A3     13946.p1chr9:
87117792-87117792
GTintergenicDe novo--Turner2016 G
SLC28A3     AU2100302chr9:
87200069-87200069
TAintergenicDe novo--Yuen2017 G
SLC28A3     2-0197-004chr9:
87064289-87064289
CCCCTCTGTCCTTTTCTCTTGCTGAGGCTintergenicDe novo--Yuen2017 G
SLC28A3     1-0777-003chr9:
87015546-87015546
GTintergenicDe novo--Yuen2017 G
SLC28A3     1-0004-003chr9:
87181381-87181381
TTAintergenicDe novo--Yuen2017 G
SLC28A3     1-0469-005chr9:
87047543-87047543
TCintergenicDe novo--Yuen2017 G
SLC28A3     AU4306302chr9:
87039671-87039671
ACintergenicDe novo--Yuen2017 G
SLC28A3     2-0081-003chr9:
86911519-86911519
GAintronicDe novo--Yuen2017 G
SLC28A3     5-0110-003chr9:
86971801-86971801
TAintronicDe novo--Yuen2017 G
SLC28A3     AU079104chr9:
87052992-87052992
GAintergenicDe novo--Yuen2017 G
SLC28A3     2-1510-003chr9:
87163296-87163311
CCTCTCTCTCTCTCTCCCTCTCTCTCTCTCintergenicDe novo--Yuen2017 G
SLC28A3     1-0269-005chr9:
87244760-87244760
AGintergenicDe novo--Yuen2017 G
SLC28A3     2-0081-003chr9:
87099603-87099603
AGintergenicDe novo--Yuen2017 G
SLC28A3     3-0482-000chr9:
87049434-87049434
GAintergenicDe novo--Yuen2017 G
SLC28A3     11239.p1chr9:
86914658-86914658
GCintronicMosaic, De novo--Dou2017 E
Krumm2015 E
SLC28A3     A27chr9:
87261820-87261820
CTintergenicDe novo--Wu2018 G
SLC28A3     2-0286-003chr9:
87251741-87251741
CCTTTCTCTCTTTCTTintergenicDe novo--Yuen2017 G
SLC28A3     2-1143-003chr9:
87207249-87207249
GAintergenicDe novo--Yuen2017 G
SLC28A3     AU3763305chr9:
87046476-87046476
CTintergenicDe novo--Yuen2017 G
SLC28A3     iHART1848chr9:
86920177-86920177
ACexonicPaternalstopgainNM_001199633
NM_022127
c.T326G
c.T326G
p.L109X
p.L109X
21.78.25E-6Ruzzo2019 G
SLC28A3     2-1644-003chr9:
86916527-86916531
TTGTGTintronicDe novo--Yuen2017 G
SLC28A3     1-0272-004chr9:
87279874-87279874
TAintergenicDe novo--Yuen2017 G
SLC28A3     2-0132-004chr9:
87208817-87208817
ATintergenicDe novo--Yuen2017 G
SLC28A3     2-0208-004chr9:
87177638-87177638
GAintergenicDe novo--Yuen2017 G
SLC28A3     SP0041645chr9:
86903067-86903067
CTexonicDe novosynonymous SNVNM_001199633
NM_022127
c.G1176A
c.G1176A
p.A392A
p.A392A
-0.0036Feliciano2019 E
SLC28A3     AU4032307chr9:
87233126-87233126
ATintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More