or
or
Exact

Results for "RNF220"

Variant Events: 24

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
RNF220     AU3768302chr1:
44890805-44890805
GAintronicDe novo--Yuen2017 G
RNF220     2-0070-004chr1:
44900146-44900146
CTintronicDe novo--Yuen2017 G
RNF220     EGAN00001101354chr1:
45111137-45111137
CTexonicDe novosynonymous SNVNM_018150c.C1422Tp.T474T12.63-Satterstrom2020 E
RNF220     AU073003chr1:
44928754-44928754
ATintronicDe novo--Yuen2017 G
RNF220     AU005213chr1:
45062579-45062579
CTintronicDe novo--Yuen2017 G
RNF220     11526.p1chr1:
45025136-45025136
ACintronicDe novo--Wilfert2021 G
RNF220     AU1742302chr1:
44936910-44936910
CTintronicDe novo--Yuen2017 G
RNF220     2-0210-005chr1:
45048054-45048054
AGintronicDe novo--Yuen2017 G
RNF220     DEASD_1033_001chr1:
45098072-45098072
GGCintronicDe novo--Satterstrom2020 E
RNF220     1-0232-004chr1:
44945078-44945078
GAintronicDe novo--Yuen2017 G
RNF220     AU4286302chr1:
44932662-44932662
TCintronicDe novo--Yuen2017 G
RNF220     2-1355-004chr1:
44991853-44991853
CTintronicDe novo--Yuen2017 G
RNF220     SP0026093chr1:
45101709-45101709
GAexonicDe novononsynonymous SNVNM_018150c.G1001Ap.G334D20.78.239E-6Feliciano2019 E
RNF220     ASDFI_1540chr1:
45098108-45098108
CTintronicDe novo-5.177E-5Satterstrom2020 E
RNF220     13572.p1chr1:
45110850-45110850
GAintronicDe novo-1.0E-4Krumm2015 E
Satterstrom2020 E
RNF220     2-1729-003chr1:
44905909-44905909
CAintronicDe novo--Yuen2017 G
RNF220     1-0004-003chr1:
45006494-45006494
ATintronicDe novo--Yuen2017 G
RNF220     1-0389-004chr1:
45091117-45091117
CTintronicDe novo--Yuen2017 G
RNF220     AU012804chr1:
45107251-45107251
GTintronicDe novo--Yuen2017 G
RNF220     AU3911302 Complex Event; expand row to view variants  De novo--Yuen2017 G
Yuen2017 G
RNF220     AU4032307chr1:
44948029-44948029
GAintronicDe novo--Yuen2017 G
RNF220     1-0453-003chr1:
44895712-44895712
CTintronicDe novo--Yuen2017 G
RNF220     1-0203-004chr1:
44936958-44936958
CTintronicDe novo--Yuen2017 G
RNF220     2-1506-003chr1:
45003049-45003064
ATGTGTGTGTGTGTGTATGTGTGTGTGTGTintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More