or
or
Exact

Results for "SLC26A4"

Variant Events: 12

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SLC26A4     iHART1462chr7:
107323898-107323898
AGsplicingPaternalsplicing19.623.0E-4Ruzzo2019 G
SLC26A4     2-1391-004chr7:
107367895-107367895
CCTCTCCTCTCCTintergenicDe novo--Yuen2017 G
SLC26A4     SP0000972chr7:
107323684-107323684
AGexonicDe novononsynonymous SNVNM_000441c.A803Gp.N268S23.84.139E-5Feliciano2019 E
SLC26A4     2-1174-005Bchr7:
107367895-107367895
CCTCTCCTCTCCTintergenicDe novo--Yuen2017 G
SLC26A4     1-0395-004chr7:
107367886-107367886
CCCTCCCCTCTCCTCTCCTTTCCTTGACAGGATCTCCTCTCTTintergenicDe novo--Yuen2017 G
SLC26A4     1-0683-004chr7:
107367882-107367882
TTCTCTTCintergenicDe novo--Yuen2017 G
SLC26A4     Lee2020:138chr7:
107323898-107323898
AGsplicingsplicing19.623.0E-4Lee2020 T
SLC26A4     1-0534-006chr7:
107377986-107377986
CTintergenicDe novo--Yuen2017 G
SLC26A4     Lee2020:138chr7:
107350577-107350577
AGexonicnonsynonymous SNVNM_000441c.A2168Gp.H723R21.21.0E-4Lee2020 T
SLC26A4     1-0253-005chr7:
107367890-107367890
CCTCTintergenicDe novo--Yuen2017 G
SLC26A4     AU3790302chr7:
107369050-107369050
TGintergenicDe novo--Yuen2017 G
SLC26A4     AU3807302chr7:
107321260-107321260
GTintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More