or
or
Exact

Results for "AGRN"

Variant Events: 14

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
AGRN     PN400495chr1:
982302-982302
CAexonicUnknownnonsynonymous SNVNM_198576c.C3353Ap.T1118K25.60.0021Leblond2019 E
AGRN     PN400279chr1:
980810-980810
CTexonicUnknownnonsynonymous SNVNM_198576c.C2443Tp.R815C16.838.563E-6Leblond2019 E
AGRN     13143.p1chr1:
989900-989900
GAexonicDe novosynonymous SNVNM_198576c.G5949Ap.T1983T--Wilfert2021 G
AGRN     08C78500chr1:
983257-983257
GAexonicDe novononsynonymous SNVNM_198576c.G3733Ap.V1245M10.932.719E-5Satterstrom2020 E
AGRN     DEASD_1021_001chr1:
983595-983595
CTexonicDe novononsynonymous SNVNM_198576c.C3955Tp.P1319S2.839-Satterstrom2020 E
AGRN     JASD_Fam0025chr1:
980641-980649
CCTGGCTGGCexonicDe novoframeshift deletionNM_198576c.2356_2363delp.L786fs--Takata2018 E
AGRN     JASD_Fam0016chr1:
955717-955717
CTexonicDe novosynonymous SNVNM_198576c.C165Tp.L55L--Takata2018 E
AGRN     AU025704chr1:
965824-965830
CTGTGTGCTGTGintronicDe novo--Yuen2017 G
AGRN     08C74054chr1:
985272-985272
CTintronicDe novo-8.736E-6Satterstrom2020 E
AGRN     iHART2565chr1:
977058-977105
CGCTCCGGCCAGTGCCAGGGTCGAGGTGAGCGGCTCCCCCGGGGGAGGCexonicMaternalnonframeshift deletionNM_198576c.1154_1177delp.385_393del-1.0E-4Ruzzo2019 G
AGRN     5-0114-003chr1:
990815-990815
CTUTR3De novo--Yuen2017 G
AGRN     iHART2564chr1:
977058-977105
CGCTCCGGCCAGTGCCAGGGTCGAGGTGAGCGGCTCCCCCGGGGGAGGCexonicMaternalnonframeshift deletionNM_198576c.1154_1177delp.385_393del-1.0E-4Ruzzo2019 G
AGRN     SP0030765chr1:
982835-982835
GAsplicingDe novosplicing8.842-Feliciano2019 E
AGRN     2-1313-003chr1:
981205-981205
TCexonicDe novononsynonymous SNVNM_198576c.T2629Cp.C877R19.31-Yuen2016 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More