or
or
Exact

Results for "HNMT"

Variant Events: 28

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
HNMT     1-0158-012chr2:
139145927-139145927
TAintergenicDe novo--Yuen2017 G
HNMT     AU007503chr2:
139007684-139007684
ACintergenicDe novo--Yuen2017 G
HNMT     2-0122-003chr2:
138802137-138802138
TCTintergenicDe novo--Yuen2017 G
HNMT     AU2139303chr2:
138996881-138996881
CAintergenicDe novo--Yuen2017 G
HNMT     2-1189-003chr2:
138850150-138850164
GTATATATATATATAGTATATATATATAintergenicDe novo--Yuen2017 G
HNMT     AU026412chr2:
138988980-138988980
AGintergenicDe novo--Yuen2017 G
HNMT     AU4199303chr2:
138950600-138950600
GTintergenicDe novo--Yuen2017 G
HNMT     1-0745-003chr2:
138896619-138896619
TCintergenicDe novo--Yuen2017 G
HNMT     AU026412chr2:
138988977-138988978
TATintergenicDe novo--Yuen2017 G
HNMT     2-1486-003chr2:
138863388-138863388
CTintergenicDe novo--Yuen2016 G
HNMT     2-1581-003chr2:
139256894-139256894
AGintergenicDe novo--Yuen2017 G
HNMT     1-0345-004chr2:
139083940-139083944
GAGAAGintergenicDe novo--Yuen2017 G
HNMT     AU031004chr2:
138897249-138897253
AAACAAAACAACAintergenicDe novo--Yuen2017 G
HNMT     1-0158-003chr2:
139175416-139175416
GAintergenicDe novo--Yuen2017 G
HNMT     7-0008-003chr2:
138722620-138722620
CTintronicDe novo--Yuen2017 G
HNMT     1-0923-003chr2:
138883307-138883307
CTintergenicDe novo--Yuen2017 G
HNMT     1-0755-003chr2:
139144419-139144419
AGintergenicDe novo--Yuen2017 G
HNMT     AU2089302chr2:
138944078-138944087
AATCATGTTTAintergenicDe novo--Yuen2017 G
HNMT     1-0558-003chr2:
138885964-138885964
CTintergenicDe novo--Yuen2017 G
HNMT     AU4423303chr2:
139121004-139121004
CTintergenicDe novo--Yuen2017 G
HNMT     AU4219302chr2:
139082787-139082787
GAintergenicDe novo--Yuen2017 G
HNMT     2-1268-003chr2:
138760177-138760177
CTintronicDe novo--Yuen2017 G
HNMT     AU3915301chr2:
138814026-138814026
TAintergenicDe novo--Yuen2017 G
HNMT     74-0075chr2:
139007684-139007684
ACintergenicDe novo--Michaelson2012 G
HNMT     2-1184-003chr2:
139136229-139136247
ATGTGTGTGTGTGTGTGTGATGTGTGTGTGTGTGTGintergenicDe novo--Yuen2017 G
HNMT     2-1105-003chr2:
138837779-138837779
GTintergenicDe novo--Yuen2016 G
Yuen2017 G
HNMT     SP0012364chr2:
138727786-138727786
ACexonicDe novosynonymous SNVNM_001024075
NM_006895
c.A189C
c.A189C
p.A63A
p.A63A
--Feliciano2019 E
HNMT     AU2793301chr2:
138839066-138839066
CTintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More