or
or
Exact

Results for "FOXP1"

Variant Events: 82

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
FOXP1     1-0368-004chr3:
71376590-71376590
GAintronicDe novo--Yuen2017 G
FOXP1     AU4237302chr3:
71100544-71100544
ATintronicDe novo--Yuen2017 G
FOXP1     HEN0212.p1chr3:
71102906-71102906
TCexonicMaternalnonsynonymous SNVNM_001244813
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.A1G
c.A307G
c.A301G
c.A301G
c.A301G
c.A301G
c.A301G
p.M1V
p.M103V
p.M101V
p.M101V
p.M101V
p.M101V
p.M101V
16.683.297E-5Guo2018 T
FOXP1     2-0057-003chr3:
71376590-71376590
GAintronicDe novo--Yuen2017 G
FOXP1     AU060004chr3:
71285982-71285991
CCACTGCACTCCACTintronicDe novo--Yuen2017 G
FOXP1     2-1134-003chr3:
71043885-71043885
GAintronicDe novo--Yuen2017 G
FOXP1     11403.p1chr3:
71026115-71026115
GAexonicDe novostopgainNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.C1207T
c.C1279T
c.C1513T
c.C1507T
c.C1507T
c.C1504T
c.C1507T
c.C1507T
p.R403X
p.R427X
p.R505X
p.R503X
p.R503X
p.R502X
p.R503X
p.R503X
37.0-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
FOXP1     GX0338.p1chr3:
71247423-71247423
GCexonicMaternalnonsynonymous SNVNM_001244814
NM_001244812
NM_001244816
NM_001012505
NM_001244808
NM_001244810
NM_032682
c.C110G
c.C110G
c.C110G
c.C110G
c.C110G
c.C110G
c.C110G
p.S37C
p.S37C
p.S37C
p.S37C
p.S37C
p.S37C
p.S37C
35.0-Guo2018 T
FOXP1     12817.p1 Complex Event; expand row to view variants  De novoframeshift insertionNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
NM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.714dupA
c.786dupA
c.1020dupA
c.1014dupA
c.1014dupA
c.1014dupA
c.1014dupA
c.1014dupA
c.714dupA
c.786dupA
c.1020dupA
c.1014dupA
c.1014dupA
c.1014dupA
c.1014dupA
c.1014dupA
p.A239fs
p.A263fs
p.A341fs
p.A339fs
p.A339fs
p.A339fs
p.A339fs
p.A339fs
p.T238fs
p.T262fs
p.T340fs
p.T338fs
p.T338fs
p.T338fs
p.T338fs
p.T338fs
--Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
Willsey2013 E
FOXP1     M21566chr3:
71064722-71064722
CTexonicPaternalnonsynonymous SNVNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.G652A
c.G724A
c.G958A
c.G952A
c.G952A
c.G952A
c.G952A
c.G952A
p.E218K
p.E242K
p.E320K
p.E318K
p.E318K
p.E318K
p.E318K
p.E318K
36.0-Guo2018 T
Wang2016 T
FOXP1     M31817chr3:
71247378-71247378
GAexonicMaternalnonsynonymous SNVNM_001244814
NM_001244812
NM_001244816
NM_001012505
NM_001244808
NM_001244810
NM_032682
c.C155T
c.C155T
c.C155T
c.C155T
c.C155T
c.C155T
c.C155T
p.A52V
p.A52V
p.A52V
p.A52V
p.A52V
p.A52V
p.A52V
33.02.486E-5Guo2018 T
FOXP1     2-1561-003chr3:
71578502-71578502
TCintronicDe novo--Yuen2017 G
FOXP1     M23720chr3:
71247418-71247418
CTexonicMaternal, Unknownnonsynonymous SNVNM_001244814
NM_001244812
NM_001244816
NM_001012505
NM_001244808
NM_001244810
NM_032682
c.G115A
c.G115A
c.G115A
c.G115A
c.G115A
c.G115A
c.G115A
p.G39R
p.G39R
p.G39R
p.G39R
p.G39R
p.G39R
p.G39R
31.01.653E-5Guo2018 T
Stessman2017 T
Wang2016 T
FOXP1     HN0004.p1chr3:
71027085-71027086
CACexonicDe novoframeshift deletionNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.941delT
c.1013delT
c.1247delT
c.1241delT
c.1241delT
c.1241delT
c.1241delT
c.1241delT
p.L314fs
p.L338fs
p.L416fs
p.L414fs
p.L414fs
p.L414fs
p.L414fs
p.L414fs
--Guo2018 T
FOXP1     80001100872chr3:
71027005-71027016
TCTGAGTACCGCTexonicDe novoframeshift deletionNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.1011_1021del
c.1083_1093del
c.1317_1327del
c.1311_1321del
c.1311_1321del
c.1311_1321del
c.1311_1321del
c.1311_1321del
p.R337fs
p.R361fs
p.R439fs
p.R437fs
p.R437fs
p.R437fs
p.R437fs
p.R437fs
--Satterstrom2020 E
FOXP1     GX0065.p1chr3:
71008420-71008420
GCexonicDe novononsynonymous SNVNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.C1712G
c.C1784G
c.C2018G
c.C2012G
c.C2012G
c.C2009G
c.C2060G
c.C2012G
p.P571R
p.P595R
p.P673R
p.P671R
p.P671R
p.P670R
p.P687R
p.P671R
11.36-Guo2018 T
FOXP1     2-1322-004chr3:
71096804-71096804
AGintronicDe novo--Yuen2017 G
FOXP1     2-1506-003chr3:
71158995-71159011
TACACACACACACACACTACACACACACACACintronicDe novo--Yuen2017 G
FOXP1     08C74834chr3:
71101750-71101750
GGTexonicDe novoframeshift insertionNM_001244813
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.147dupA
c.453dupA
c.447dupA
c.447dupA
c.447dupA
c.447dupA
c.447dupA
p.Q50fs
p.Q152fs
p.Q150fs
p.Q150fs
p.Q150fs
p.Q150fs
p.Q150fs
--Satterstrom2020 E
FOXP1     217-14296-4170chr3:
71101750-71101751
GTGTGTexonicDe novoframeshift insertionNM_001244813
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.146_147insAC
c.452_453insAC
c.446_447insAC
c.446_447insAC
c.446_447insAC
c.446_447insAC
c.446_447insAC
p.K49fs
p.K151fs
p.K149fs
p.K149fs
p.K149fs
p.K149fs
p.K149fs
--Stessman2017 T
FOXP1     SP0026093chr3:
71019886-71019886
CCCTGTAAAGCTGCAsplicingDe novosplicing--Feliciano2019 E
FOXP1     AU4186302chr3:
71049338-71049338
ATintronicDe novo--Yuen2017 G
FOXP1     2-1391-003chr3:
71093290-71093290
GCintronicDe novo--Yuen2017 G
FOXP1     2-1391-003chr3:
71093110-71093110
TCintronicDe novo--Yuen2017 G
FOXP1     7-0248-003chr3:
71316025-71316025
CTintronicDe novo--Yuen2017 G
FOXP1     AU031204chr3:
71425749-71425749
GAintronicDe novo--Yuen2017 G
FOXP1     GX0296.p1chr3:
71247153-71247153
GTexonicMaternalnonsynonymous SNVNM_001012505c.C247Ap.P83T15.86-Guo2018 T
FOXP1     M30624chr3:
71027165-71027165
TTTGATACCAGATTCAACTGCAAGGAAAAAAACAACGTCTTAexonicMaternalstopgainNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.861_862insTAAGACGTTGTTTTTTTCCTTGCAGTTGAATCTGGTATCA
c.933_934insTAAGACGTTGTTTTTTTCCTTGCAGTTGAATCTGGTATCA
c.1167_1168insTAAGACGTTGTTTTTTTCCTTGCAGTTGAATCTGGTATCA
c.1161_1162insTAAGACGTTGTTTTTTTCCTTGCAGTTGAATCTGGTATCA
c.1161_1162insTAAGACGTTGTTTTTTTCCTTGCAGTTGAATCTGGTATCA
c.1161_1162insTAAGACGTTGTTTTTTTCCTTGCAGTTGAATCTGGTATCA
c.1161_1162insTAAGACGTTGTTTTTTTCCTTGCAGTTGAATCTGGTATCA
c.1161_1162insTAAGACGTTGTTTTTTTCCTTGCAGTTGAATCTGGTATCA
p.S288_V289delinsX
p.S312_V313delinsX
p.S390_V391delinsX
p.S388_V389delinsX
p.S388_V389delinsX
p.S388_V389delinsX
p.S388_V389delinsX
p.S388_V389delinsX
--Guo2018 T
FOXP1     Chen2017:85chr3:
71027145-71027145
GGGACTTexonicDe novoframeshift insertionNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.881_882insAAGTC
c.953_954insAAGTC
c.1187_1188insAAGTC
c.1181_1182insAAGTC
c.1181_1182insAAGTC
c.1181_1182insAAGTC
c.1181_1182insAAGTC
c.1181_1182insAAGTC
p.S294fs
p.S318fs
p.S396fs
p.S394fs
p.S394fs
p.S394fs
p.S394fs
p.S394fs
--Chen2017 E
FOXP1     1-0385-003chr3:
71479406-71479406
CAintronicDe novo--Yuen2017 G
FOXP1     M02533chr3:
71247153-71247153
GTexonicMaternalnonsynonymous SNVNM_001012505c.C247Ap.P83T15.86-Guo2018 T
FOXP1     M26811chr3:
71179825-71179825
ATexonicMaternalnonsynonymous SNVNM_001244815c.T10Ap.C4S12.92-Guo2018 T
FOXP1     11942.p1chr3:
71592594-71592594
CTUTR5Mosaic--Dou2017 E
FOXP1     200675573@1082035017chr3:
71027145-71027145
GGGACTTexonicDe novoframeshift insertionNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.881_882insAAGTC
c.953_954insAAGTC
c.1187_1188insAAGTC
c.1181_1182insAAGTC
c.1181_1182insAAGTC
c.1181_1182insAAGTC
c.1181_1182insAAGTC
c.1181_1182insAAGTC
p.S294fs
p.S318fs
p.S396fs
p.S394fs
p.S394fs
p.S394fs
p.S394fs
p.S394fs
--Satterstrom2020 E
FOXP1     M16136chr3:
71015162-71015162
TCexonicMaternalnonsynonymous SNVNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.A1468G
c.A1540G
c.A1774G
c.A1768G
c.A1768G
c.A1765G
c.A1816G
c.A1768G
p.M490V
p.M514V
p.M592V
p.M590V
p.M590V
p.M589V
p.M606V
p.M590V
14.794.119E-5Guo2018 T
FOXP1     M26196chr3:
71015104-71015104
GAexonicMaternalnonsynonymous SNVNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.C1526T
c.C1598T
c.C1832T
c.C1826T
c.C1826T
c.C1823T
c.C1874T
c.C1826T
p.A509V
p.A533V
p.A611V
p.A609V
p.A609V
p.A608V
p.A625V
p.A609V
17.941.647E-5Guo2018 T
FOXP1     5-0129-003chr3:
71159238-71159238
CTintronicDe novo--Yuen2017 G
FOXP1     AU4237301chr3:
71100544-71100544
ATintronicDe novo--Yuen2017 G
FOXP1     1-0032-003chr3:
71376590-71376590
GAintronicDe novo--Yuen2017 G
FOXP1     JS0070.p1chr3:
71027086-71027086
AAGexonicDe novoframeshift insertionNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.940dupC
c.1012dupC
c.1246dupC
c.1240dupC
c.1240dupC
c.1240dupC
c.1240dupC
c.1240dupC
p.L314fs
p.L338fs
p.L416fs
p.L414fs
p.L414fs
p.L414fs
p.L414fs
p.L414fs
--Guo2018 T
FOXP1     1-0329-004chr3:
71658089-71658089
CTintergenicDe novo--Yuen2017 G
FOXP1     Ohashi2021:ASD-160chr3:
71026789-71026789
CTintronic--Ohashi2021 ET
FOXP1     217-14254-3770chr3:
71050205-71050205
AGexonicUnknownnonsynonymous SNVNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.T680C
c.T752C
c.T986C
c.T980C
c.T980C
c.T980C
c.T980C
c.T980C
p.L227P
p.L251P
p.L329P
p.L327P
p.L327P
p.L327P
p.L327P
p.L327P
23.4-Stessman2017 T
FOXP1     Cherot2017:2chr3:
71026977-71026977
AGsplicingUnknownsplicing22.0-Cherot2017 E
FOXP1     AU1860302chr3:
71251048-71251048
AGintronicDe novo--Yuen2017 G
FOXP1     2-1644-003chr3:
71572853-71572853
GGAintronicDe novo--Yuen2017 G
FOXP1     GX0366.p1chr3:
71247423-71247423
GCexonicUnknownnonsynonymous SNVNM_001244814
NM_001244812
NM_001244816
NM_001012505
NM_001244808
NM_001244810
NM_032682
c.C110G
c.C110G
c.C110G
c.C110G
c.C110G
c.C110G
c.C110G
p.S37C
p.S37C
p.S37C
p.S37C
p.S37C
p.S37C
p.S37C
35.0-Guo2018 T
FOXP1     SX0015.p1chr3:
71096193-71096193
CTexonicPaternalnonsynonymous SNVNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.G264A
c.G336A
c.G570A
c.G564A
c.G564A
c.G564A
c.G564A
c.G564A
p.M88I
p.M112I
p.M190I
p.M188I
p.M188I
p.M188I
p.M188I
p.M188I
16.31-Guo2018 T
FOXP1     GX0547.p1chr3:
71179794-71179798
TGCGGTexonicMaternalframeshift deletionNM_001244815c.37_40delp.P13fs--Guo2018 T
FOXP1     195485chr3:
71179778-71179789
TAAACAGGAAGTTexonicMaternalframeshift deletionNM_001244815c.46_56delp.T16fs--Stessman2017 T
FOXP1     AU3586303chr3:
71117741-71117741
GAintronicDe novo--Yuen2017 G
FOXP1     AU4269301chr3:
71169564-71169564
CTintronicDe novo--Yuen2017 G
FOXP1     Mahjani2021:106chr3:
71026184-71026184
CTexonicnonsynonymous SNVNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.G1138A
c.G1210A
c.G1444A
c.G1438A
c.G1438A
c.G1435A
c.G1438A
c.G1438A
p.E380K
p.E404K
p.E482K
p.E480K
p.E480K
p.E479K
p.E480K
p.E480K
25.7-Mahjani2021 E
FOXP1     M01483chr3:
71015120-71015120
CTexonicMaternalnonsynonymous SNVNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.G1510A
c.G1582A
c.G1816A
c.G1810A
c.G1810A
c.G1807A
c.G1858A
c.G1810A
p.E504K
p.E528K
p.E606K
p.E604K
p.E604K
p.E603K
p.E620K
p.E604K
36.0-Guo2018 T
Wang2016 T
FOXP1     1-0285-003chr3:
71263767-71263767
ATintronicDe novo--Yuen2017 G
FOXP1     AU3891303chr3:
71443178-71443178
CTintronicDe novo--Yuen2017 G
FOXP1     HN0001.p1chr3:
71247125-71247125
GAexonicPaternalnonsynonymous SNVNM_001012505c.C275Tp.P92L15.78-Guo2018 T
FOXP1     Mahjani2021:110chr3:
71027005-71027016
TCTGAGTACCGCTexonicframeshift deletionNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.1011_1021del
c.1083_1093del
c.1317_1327del
c.1311_1321del
c.1311_1321del
c.1311_1321del
c.1311_1321del
c.1311_1321del
p.R337fs
p.R361fs
p.R439fs
p.R437fs
p.R437fs
p.R437fs
p.R437fs
p.R437fs
--Mahjani2021 E
FOXP1     GX0101.p1chr3:
71027165-71027165
TCexonicPaternalnonsynonymous SNVNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.A862G
c.A934G
c.A1168G
c.A1162G
c.A1162G
c.A1162G
c.A1162G
c.A1162G
p.S288G
p.S312G
p.S390G
p.S388G
p.S388G
p.S388G
p.S388G
p.S388G
15.19-Guo2018 T
FOXP1     2-1693-003chr3:
71037477-71037477
GAintronicDe novo--Yuen2017 G
FOXP1     F10016-1chr3:
71021818-71021818
GAexonicDe novononsynonymous SNVNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_032682
c.C1240T
c.C1312T
c.C1546T
c.C1540T
c.C1540T
c.C1537T
c.C1540T
p.R414C
p.R438C
p.R516C
p.R514C
p.R514C
p.R513C
p.R514C
21.4-Satterstrom2020 E
FOXP1     SSC00370chr3:
71026115-71026115
GAexonicDe novostopgainNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.C1207T
c.C1279T
c.C1513T
c.C1507T
c.C1507T
c.C1504T
c.C1507T
c.C1507T
p.R403X
p.R427X
p.R505X
p.R503X
p.R503X
p.R502X
p.R503X
p.R503X
37.0-Lim2017 E
FOXP1     08C72698chr3:
71050205-71050205
AGexonicDe novononsynonymous SNVNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.T680C
c.T752C
c.T986C
c.T980C
c.T980C
c.T980C
c.T980C
c.T980C
p.L227P
p.L251P
p.L329P
p.L327P
p.L327P
p.L327P
p.L327P
p.L327P
23.4-Satterstrom2020 E
FOXP1     2-1093-009chr3:
71484353-71484353
GGGGAintronicDe novo--Yuen2017 G
FOXP1     AU3859301chr3:
71247280-71247280
CTintronicDe novo--Yuen2017 G
FOXP1     2-1148-004chr3:
71337579-71337579
AGintronicDe novo--Yuen2017 G
FOXP1     G01-GEA-36-HIchr3:
71021817-71021817
CTexonicDe novononsynonymous SNVNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_032682
c.G1241A
c.G1313A
c.G1547A
c.G1541A
c.G1541A
c.G1538A
c.G1541A
p.R414H
p.R438H
p.R516H
p.R514H
p.R514H
p.R513H
p.R514H
23.4-Lim2017 E
Satterstrom2020 E
FOXP1     7-0249-004chr3:
71384745-71384745
TCintronicDe novo--Yuen2017 G
FOXP1     1-0161-003chr3:
71067022-71067024
CTGCintronicDe novo--Yuen2017 G
FOXP1     2-1174-006chr3:
71242618-71242618
TTGintronicDe novo--Yuen2017 G
FOXP1     F1561-1chr3:
71096108-71096108
GAexonicDe novostopgainNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.C349T
c.C421T
c.C655T
c.C649T
c.C649T
c.C649T
c.C649T
c.C649T
p.Q117X
p.Q141X
p.Q219X
p.Q217X
p.Q217X
p.Q217X
p.Q217X
p.Q217X
37.0-Satterstrom2020 E
FOXP1     M13295chr3:
71247198-71247198
GTexonicPaternalnonsynonymous SNVNM_001012505c.C202Ap.P68T12.29-Guo2018 T
FOXP1     M19747chr3:
71015168-71015168
CTexonicPaternalnonsynonymous SNVNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.G1462A
c.G1534A
c.G1768A
c.G1762A
c.G1762A
c.G1759A
c.G1810A
c.G1762A
p.A488T
p.A512T
p.A590T
p.A588T
p.A588T
p.A587T
p.A604T
p.A588T
22.73.0E-4Guo2018 T
FOXP1     211-5583-3chr3:
71064721-71064721
TAexonicUnknownnonsynonymous SNVNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.A653T
c.A725T
c.A959T
c.A953T
c.A953T
c.A953T
c.A953T
c.A953T
p.E218V
p.E242V
p.E320V
p.E318V
p.E318V
p.E318V
p.E318V
p.E318V
29.5-Stessman2017 T
FOXP1     11625.p1chr3:
71593936-71593936
TCintronicDe novo--Wilfert2021 G
FOXP1     2-0135-003chr3:
71086862-71086862
GAintronicDe novo--Yuen2017 G
FOXP1     Stessman2017:ASD_1287-1chr3:
71015108-71015108
CTexonicUnknownnonsynonymous SNVNM_001244813
NM_001244812
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.G1522A
c.G1594A
c.G1828A
c.G1822A
c.G1822A
c.G1819A
c.G1870A
c.G1822A
p.G508R
p.G532R
p.G610R
p.G608R
p.G608R
p.G607R
p.G624R
p.G608R
35.01.647E-5Stessman2017 T
FOXP1     M17539chr3:
71247408-71247408
GAexonicMaternalnonsynonymous SNVNM_001244814
NM_001244812
NM_001244816
NM_001012505
NM_001244808
NM_001244810
NM_032682
c.C125T
c.C125T
c.C125T
c.C125T
c.C125T
c.C125T
c.C125T
p.P42L
p.P42L
p.P42L
p.P42L
p.P42L
p.P42L
p.P42L
32.08.266E-6Wang2016 T
FOXP1     AU2129301chr3:
71191380-71191380
AGintronicDe novo--Yuen2017 G
FOXP1     M02393chr3:
71247423-71247423
GCexonicPaternalnonsynonymous SNVNM_001244814
NM_001244812
NM_001244816
NM_001012505
NM_001244808
NM_001244810
NM_032682
c.C110G
c.C110G
c.C110G
c.C110G
c.C110G
c.C110G
c.C110G
p.S37C
p.S37C
p.S37C
p.S37C
p.S37C
p.S37C
p.S37C
35.0-Guo2018 T
Wang2016 T
FOXP1     SP0010429chr3:
71101750-71101751
GTGexonicDe novoframeshift deletionNM_001244813
NM_001244815
NM_001244814
NM_001244816
NM_001244808
NM_001244810
NM_032682
c.147delA
c.453delA
c.447delA
c.447delA
c.447delA
c.447delA
c.447delA
p.K49fs
p.K151fs
p.K149fs
p.K149fs
p.K149fs
p.K149fs
p.K149fs
--Feliciano2019 E
FOXP1     M12496chr3:
71247408-71247408
GAexonicMaternalnonsynonymous SNVNM_001244814
NM_001244812
NM_001244816
NM_001012505
NM_001244808
NM_001244810
NM_032682
c.C125T
c.C125T
c.C125T
c.C125T
c.C125T
c.C125T
c.C125T
p.P42L
p.P42L
p.P42L
p.P42L
p.P42L
p.P42L
p.P42L
32.08.266E-6Wang2016 T
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More