or
or
Exact

Results for "HSPBP1"

Variant Events: 11

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
HSPBP1     SP0035025chr19:
55789166-55789166
GAexonicDe novononsynonymous SNVNM_001297600
NM_012267
NM_001130106
c.C397T
c.C259T
c.C259T
p.R133W
p.R87W
p.R87W
19.284.889E-5Feliciano2019 E
HSPBP1     2-0127-004chr19:
55777768-55777768
TTCACTATCACintronicDe novo--Yuen2017 G
HSPBP1     2-0202-003chr19:
55777756-55777756
TTCTCTACCACintronicDe novo--Yuen2017 G
HSPBP1     Al-Mubarak2017:ASD-18chr19:
55774040-55774040
TGexonicUnknownnonsynonymous SNVNM_001297600
NM_012267
NM_001130106
c.A1154C
c.A1016C
c.A1016C
p.E385A
p.E339A
p.E339A
14.92-Al-Mubarak2017 E
HSPBP1     2-0285-003chr19:
55777753-55777753
TTCACintronicDe novo--Yuen2017 G
HSPBP1     7-0095-003chr19:
55777753-55777753
TTCACCATCACCAACATCACintronicDe novo--Yuen2017 G
HSPBP1     1-0051-005chr19:
55777754-55777754
CCACCATCACTintronicDe novo--Yuen2017 G
HSPBP1     1-0141-003chr19:
55777710-55777710
AACintronicDe novo--Yuen2017 G
HSPBP1     1-0269-003chr19:
55778039-55778039
AATCACCATTATCintronicDe novo--Yuen2017 G
HSPBP1     PN400349chr19:
55776729-55776729
GAexonicUnknownnonsynonymous SNVNM_001297600
NM_012267
NM_001130106
c.C1060T
c.C922T
c.C922T
p.R354C
p.R308C
p.R308C
12.748.33E-6Leblond2019 E
HSPBP1     2-1505-004chr19:
55777739-55777739
CCACCATCATCACCATGintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More