or
or
Exact

Results for "ATP11A"

Variant Events: 23

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ATP11A     2-1252-003chr13:
113609372-113609372
GAintergenicDe novo--Yuen2017 G
ATP11A     AU3716302chr13:
113539493-113539501
CACAATACACACAUTR3De novo--Yuen2017 G
ATP11A     SP0000406chr13:
113510373-113510373
CTexonicDe novononsynonymous SNVNM_015205
NM_032189
c.C2392T
c.C2392T
p.R798C
p.R798C
30.02.495E-5Feliciano2019 E
ATP11A     09C85650chr13:
113530101-113530101
AGexonicDe novononsynonymous SNVNM_015205
NM_032189
c.A3173G
c.A3173G
p.N1058S
p.N1058S
1.824.137E-5DeRubeis2014 E
Kosmicki2017 E
Satterstrom2020 E
ATP11A     2-0122-003chr13:
113479875-113479875
CTexonicDe novononsynonymous SNVNM_015205
NM_032189
c.C1004T
c.C1004T
p.S335L
p.S335L
8.931.662E-5Yuen2015 G
Yuen2017 G
ATP11A     AU002405chr13:
113467728-113467728
CTintronicDe novo--Yuen2017 G
ATP11A     21739-34571chr13:
113536239-113536241
ACTAexonicframeshift deletionNM_032189c.3438_3439delp.H1146fs-6.0E-4Callaghan2019 G
ATP11A     2-0197-004chr13:
113592059-113592059
TTTGintergenicDe novo--Yuen2017 G
ATP11A     1-0445-003chr13:
113384385-113384385
TCintronicDe novo--Yuen2017 G
ATP11A     2-0304-003chr13:
113589044-113589044
CTintergenicDe novo--Yuen2017 G
ATP11A     2-0007-004chr13:
113592063-113592063
CCGCTAATTGGTTGGTintergenicDe novo--Yuen2017 G
ATP11A     7-0106-003chr13:
113464668-113464668
TCintronicDe novo--Yuen2017 G
ATP11A     1-0330-003chr13:
113365065-113365065
AGintronicDe novo--Yuen2017 G
ATP11A     AU3725302chr13:
113366743-113366743
CAintronicDe novo--Yuen2017 G
ATP11A     2-1317-003chr13:
113586933-113586933
GAintergenicDe novo--Yuen2016 G
ATP11A     14033.p1chr13:
113516804-113516804
CTexonicMosaicnonsynonymous SNVNM_015205
NM_032189
c.C2906T
c.C2906T
p.T969M
p.T969M
15.91.658E-5Krupp2017 E
ATP11A     1-0303-003chr13:
113535120-113535120
AGintronicDe novo--Yuen2017 G
ATP11A     AU4392301chr13:
113441991-113441991
CGintronicDe novo--Yuen2017 G
ATP11A     1-0067-005chr13:
113480747-113480747
GAintronicDe novo--Yuen2017 G
ATP11A     AU2495302chr13:
113361823-113361823
AGintronicDe novo--Yuen2017 G
ATP11A     AU045512chr13:
113567070-113567081
CTGTGTGTGTGTCTGTGTGTintergenicDe novo--Yuen2017 G
ATP11A     13234.p1chr13:
113474289-113474289
GTintronicDe novo--Iossifov2012 E
Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
ATP11A     1-0261-003chr13:
113523385-113523385
GAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More