or
or
Exact

Results for "SHISA9"

Variant Events: 76

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SHISA9     74-0115chr16:
13219055-13219055
ACintronicDe novo--Michaelson2012 G
SHISA9     2-0126-004chr16:
13426787-13426787
GCintergenicDe novo--Yuen2017 G
SHISA9     2-1562-004chr16:
13243092-13243093
GAGintronicDe novo--Yuen2017 G
SHISA9     1-0560-003chr16:
13919342-13919342
CTintergenicDe novo--Yuen2017 G
SHISA9     AU3900302chr16:
13490720-13490720
TAintergenicDe novo--Yuen2017 G
SHISA9     AU3900302chr16:
13490887-13490887
GCintergenicDe novo--Yuen2017 G
SHISA9     2-1231-003chr16:
13428718-13428718
ATintergenicDe novo--Yuen2016 G
Yuen2017 G
SHISA9     2-1529-003chr16:
13176059-13176062
GACAGAintronicDe novo--Yuen2017 G
SHISA9     2-0306-003chr16:
13507354-13507354
TGintergenicDe novo--Yuen2016 G
SHISA9     A22chr16:
13630761-13630764
ATGTAintergenicDe novo--Wu2018 G
SHISA9     2-1730-003chr16:
13115819-13115819
ATintronicDe novo--Yuen2017 G
SHISA9     2-1290-004chr16:
13594046-13594046
CTintergenicDe novo--Yuen2017 G
SHISA9     1-0175-004chr16:
13486681-13486681
AGintergenicDe novo--Yuen2017 G
SHISA9     2-1005-003chr16:
13059264-13059275
ACTCCTTTCTCCACTCCintronicDe novo--Yuen2017 G
SHISA9     2-1279-003chr16:
13936606-13936606
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
SHISA9     1-0512-003chr16:
13691100-13691115
CAGAGAGAGAGAGAGACAGAGAGAGAGAGAintergenicDe novo--Yuen2017 G
SHISA9     7-0250-003chr16:
13119882-13119882
GAintronicDe novo--Yuen2017 G
SHISA9     2-1152-003chr16:
13313771-13313771
CTintronicDe novo--Yuen2016 G
Yuen2017 G
SHISA9     2-1440-003chr16:
13261361-13261361
ATintronicDe novo--Yuen2016 G
Yuen2017 G
SHISA9     AU2129301chr16:
13156193-13156193
AGintronicDe novo--Yuen2017 G
SHISA9     1-0175-003chr16:
13486681-13486681
AGintergenicDe novo--Yuen2017 G
SHISA9     2-1391-004chr16:
13145347-13145347
CTintronicDe novo--Yuen2017 G
SHISA9     AU051504chr16:
13047043-13047043
ATintronicDe novo--Yuen2017 G
SHISA9     1-0296-004chr16:
13774148-13774148
TAintergenicDe novo--Yuen2017 G
SHISA9     AU3937301chr16:
13433569-13433569
GAintergenicDe novo--Yuen2017 G
SHISA9     1-0377-003chr16:
13089250-13089250
ACintronicDe novo--Yuen2017 G
SHISA9     2-0007-003chr16:
13082727-13082727
AGintronicDe novo--Yuen2017 G
SHISA9     1-0206-003chr16:
13774466-13774466
CTintergenicDe novo--Yuen2017 G
SHISA9     2-0244-003chr16:
13077636-13077636
TGintronicDe novo--Yuen2017 G
SHISA9     A17chr16:
13966830-13966830
TGintergenicDe novo--Wu2018 G
SHISA9     AU3874301chr16:
13265545-13265545
GAintronicDe novo--Yuen2017 G
SHISA9     AU4159301chr16:
13586424-13586424
GAintergenicDe novo--Yuen2017 G
SHISA9     2-1437-003chr16:
13815806-13815806
CTintergenicDe novo--Yuen2017 G
SHISA9     2-1521-003chr16:
13106885-13106898
GTCTCTCTCTCTCTGTCTCTCTCTCTintronicDe novo--Yuen2017 G
SHISA9     AU003406chr16:
13877389-13877389
CTintergenicDe novo--Yuen2017 G
SHISA9     AU072905chr16:
13669233-13669235
CCACintergenicDe novo--Yuen2017 G
SHISA9     AU072905chr16:
13669239-13669239
ACintergenicDe novo--Yuen2017 G
SHISA9     AU4306302chr16:
13567150-13567150
GCintergenicDe novo--Yuen2017 G
SHISA9     2-1176-003chr16:
13003495-13003495
CTUTR3De novo--Yuen2017 G
SHISA9     AU3517302chr16:
13010813-13010813
AGintronicDe novo--Yuen2017 G
SHISA9     1-0049-004chr16:
13129138-13129138
GGTAAintronicDe novo--Yuen2017 G
SHISA9     2-1323-003chr16:
13346141-13346141
GTintergenicDe novo--Yuen2016 G
Yuen2017 G
SHISA9     AU008505chr16:
13589757-13589757
ATintergenicDe novo--Yuen2017 G
SHISA9     AU4286302chr16:
13077363-13077367
TGAGATGAintronicDe novo--Yuen2017 G
SHISA9     1-0059-003chr16:
13571771-13571771
GAintergenicDe novo--Yuen2017 G
SHISA9     2-0306-004chr16:
13507354-13507354
TGintergenicDe novo--Yuen2017 G
SHISA9     2-0215-003chr16:
13223967-13223967
TAintronicDe novo--Yuen2017 G
SHISA9     7-0002-003chr16:
13222178-13222178
GAintronicDe novo--Yuen2017 G
SHISA9     7-0222-003chr16:
13070038-13070038
GAintronicDe novo--Yuen2017 G
SHISA9     AU4412302chr16:
13063423-13063423
GAintronicDe novo--Yuen2017 G
SHISA9     2-0145-004chr16:
13423933-13423933
CTintergenicDe novo--Yuen2017 G
SHISA9     1-0559-003chr16:
13569788-13569788
GAintergenicDe novo--Yuen2017 G
SHISA9     1-0173-004chr16:
13730355-13730355
GAintergenicDe novo--Yuen2017 G
SHISA9     11341.p1chr16:
13065569-13065569
CTintronicDe novo--Turner2016 G
SHISA9     AU3777301chr16:
13707475-13707475
TAintergenicDe novo--Yuen2017 G
SHISA9     2-1163-003chr16:
13583711-13583711
CAintergenicDe novo--Yuen2017 G
SHISA9     1-0495-003chr16:
13581321-13581321
GTintergenicDe novo--Yuen2017 G
SHISA9     SP0129496chr16:
12995972-12995972
CAexonicDe novostopgainNM_001145204
NM_001145205
c.C51A
c.C51A
p.C17X
p.C17X
39.0-Fu2022 E
SHISA9     2-1212-003chr16:
13914975-13914975
TCintergenicDe novo--Yuen2017 G
SHISA9     2-1261-004chr16:
13774466-13774466
CTintergenicDe novo--Yuen2017 G
SHISA9     1-0162-004chr16:
13032314-13032314
GCintronicDe novo--Yuen2017 G
SHISA9     2-0225-004chr16:
13433071-13433071
TAintergenicDe novo--Yuen2017 G
SHISA9     AU2248301chr16:
13116149-13116149
CAintronicDe novo--Yuen2017 G
SHISA9     2-1456-004chr16:
13079076-13079076
CTintronicDe novo--Yuen2017 G
SHISA9     1-0214-003chr16:
13143741-13143741
GAintronicDe novo--Yuen2017 G
SHISA9     A11chr16:
13679664-13679664
GTintergenicDe novo--Wu2018 G
SHISA9     AU3692302chr16:
13992466-13992466
AGintergenicDe novo--Yuen2017 G
SHISA9     1-0010-003chr16:
13833066-13833074
TCATAGCGATintergenicDe novo--Yuen2017 G
SHISA9     2-1451-004chr16:
13925690-13925690
TCintergenicDe novo--Yuen2017 G
SHISA9     AU3720302chr16:
13888660-13888660
CGintergenicDe novo--Yuen2017 G
SHISA9     AU3720302chr16:
13888879-13888879
GCintergenicDe novo--Yuen2017 G
SHISA9     2-1522-003chr16:
13211464-13211464
CTintronicDe novo--Yuen2017 G
SHISA9     1-0244-003chr16:
13739889-13739889
ATintergenicDe novo--Yuen2017 G
SHISA9     AU4060306chr16:
13698830-13698830
CTintergenicDe novo--Yuen2017 G
SHISA9     1-0381-003chr16:
13514407-13514407
GAintergenicDe novo--Yuen2017 G
SHISA9     A8chr16:
13057026-13057026
AGintronicDe novo--Wu2018 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More