
Results for "MUC5B"

Variant Events: 36

Gene symbol on which the variant is located
Subject Identifier from the original study
Genomic location of the reference allele
Reference allele
Alternate allele
Variant functional categories
Variant validation performed by an orthogonal method and reported
Reported inheritance status
Variant effect on transcript per Annovar
Transcript used for the cDNA/Protein mutation
cDNA variant notation
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Source(s) where variants from this event are reported
MUC5B     12447.p1chr11:
CAexonicDe novononsynonymous SNVNM_002458c.C12150Ap.H4050Q3.389-Krumm2015 E
MUC5B     EGAN00001100985chr11:
TGintronicDe novo-6.0E-4Satterstrom2020 E
MUC5B     AU2433302chr11:
ACexonicDe novononsynonymous SNVNM_002458c.A3368Cp.E1123A13.05-Yuen2017 G
MUC5B     08C73088chr11:
GAUTR3De novo-2.0E-4Satterstrom2020 E
MUC5B     EGAN00001101030chr11:
TGintronicDe novo-6.0E-4Satterstrom2020 E
MUC5B     G01-GEA-262-HIchr11:
CTexonicDe novosynonymous SNVNM_002458c.C17208Tp.G5736G--Fu2022 E
Satterstrom2020 E
MUC5B     21742-34594chr11:
CTGCexonicframeshift deletionNM_002458c.14513_14514delp.L4838fs--Callaghan2019 G
MUC5B     21742-34594chr11:
CCTGexonicframeshift insertionNM_002458c.14510_14511insTGp.T4837fs--Callaghan2019 G
MUC5B     1-1000-003chr11:
GCCACCACCACCACCACCGCCACCACCACCACCexonicDe novononframeshift deletionNM_002458c.4870_4872delp.1624_1624del--Yuen2017 G
MUC5B     SP0006011chr11:
CAexonicDe novostopgainNM_002458c.C303Ap.Y101X32.0-Fu2022 E
MUC5B     11957.p1chr11:
GTexonicDe novononsynonymous SNVNM_002458c.G12521Tp.C4174F10.5-Ji2016 E
Krumm2015 E
MUC5B     12779.p1chr11:
CTexonicDe novononsynonymous SNVNM_002458c.C14990Tp.P4997L6.0987.135E-5Iossifov2012 E
Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
MUC5B     SSC06612chr11:
CTexonicDe novononsynonymous SNVNM_002458c.C14990Tp.P4997L6.0987.135E-5Fu2022 E
Lim2017 E
MUC5B     SSC04242chr11:
GTexonicDe novononsynonymous SNVNM_002458c.G12521Tp.C4174F10.5-Fu2022 E
Lim2017 E
MUC5B     12951.p1chr11:
CTexonicDe novononsynonymous SNVNM_002458c.C7796Tp.T2599I0.460.0271Iossifov2012 E
MUC5B     13502.p1chr11:
GAexonicDe novosynonymous SNVNM_002458c.G12297Ap.T4099T-3.0E-4Iossifov2012 E
Iossifov2014 E
Kosmicki2017 E
MUC5B     SP0059384chr11:
TGexonicDe novononsynonymous SNVNM_002458c.T158Gp.V53G9.507-Fu2022 E
MUC5B     SP0087094chr11:
GAexonicDe novononsynonymous SNVNM_002458c.G3877Ap.G1293S17.59-Fu2022 E
MUC5B     SP0052503chr11:
GCexonicDe novononsynonymous SNVNM_002458c.G412Cp.G138R11.26-Fu2022 E
MUC5B     11078.p1chr11:
CAexonicDe novo, MosaicstopgainNM_002458c.C1937Ap.S646X38.0-Dou2017 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
MUC5B     14183.p1chr11:
CTexonicDe novononsynonymous SNVNM_002458c.C5012Tp.T1671M10.44-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Wilfert2021 G
MUC5B     11653.p1chr11:
TCexonicDe novosynonymous SNVNM_002458c.T6048Cp.T2016T-0.0273Iossifov2014 E
Kosmicki2017 E
MUC5B     11653.p1chr11:
TCexonicDe novononsynonymous SNVNM_002458c.T7721Cp.V2574A3.8710.0206Iossifov2014 E
Kosmicki2017 E
MUC5B     11653.p1chr11:
CTexonicDe novononsynonymous SNVNM_002458c.C11648Tp.T3883M3.3728.0E-4Iossifov2014 E
Kosmicki2017 E
MUC5B     SP0023343chr11:
TCexonicDe novosynonymous SNVNM_002458c.T14586Cp.G4862G-0.0018Fu2022 E
MUC5B     13983.p1chr11:
CAexonicDe novononsynonymous SNVNM_002458c.C11659Ap.P3887T3.2560.0146Iossifov2014 E
Kosmicki2017 E
MUC5B     2-0323-003chr11:
CAintronicDe novo--Yuen2017 G
MUC5B     SP0086279chr11:
GAexonicDe novosynonymous SNVNM_002458c.G7269Ap.T2423T-4.854E-5Fu2022 E
MUC5B     11653.p1chr11:
GCACAACCACCACACCGexonicDe novononframeshift deletionNM_002458c.13860_13874delp.4620_4625del-6.761E-5Iossifov2014 E
Kosmicki2017 E
MUC5B     AU4239301chr11:
CTexonicDe novosynonymous SNVNM_002458c.C9009Tp.T3003T-0.0067Yuen2017 G
MUC5B     SP0057352chr11:
MUC5B     SP0043880chr11:
CTexonicDe novononsynonymous SNVNM_002458c.C13211Tp.A4404V5.888-Fu2022 E
MUC5B     SP0040467chr11:
AGexonicDe novononsynonymous SNVNM_002458c.A10054Gp.I3352V5.8493.276E-5Fu2022 E
MUC5B     SP0008087chr11:
CTexonicDe novosynonymous SNVNM_002458c.C2817Tp.T939T-4.233E-5Fu2022 E
MUC5B     14183_p1chr11:
CTexonicDe novononsynonymous SNVNM_002458c.C5012Tp.T1671M10.44-Fu2022 E
MUC5B     SP0051229chr11:
ATexonicDe novononsynonymous SNVNM_002458c.A14227Tp.T4743S3.905-Fu2022 E
Source Variant Information

, -


Paper alias:

No records found.
Paper Information
Variant source
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView