or
or
Exact

Results for "MED13"

Variant Events: 28

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
MED13     2-1195-003chr17:
60049152-60049152
GAintronicDe novo--Yuen2016 G
MED13     2-1735-003chr17:
60195949-60195949
GAintergenicDe novo--Yuen2017 G
MED13     AU054303chr17:
60099301-60099301
GAintronicDe novo--Yuen2017 G
MED13     1-0572-003chr17:
60067950-60067964
CTATATATATATATACTATATATATATAintronicDe novo--Yuen2017 G
MED13     1-0259-005chr17:
60062132-60062132
AGexonicDe novosynonymous SNVNM_005121c.T2571Cp.Y857Y--Yuen2017 G
MED13     AU3918302chr17:
60034871-60034871
CTintronicDe novo--Yuen2017 G
MED13     1-0701-003chr17:
60106933-60106933
CTexonicDe novononsynonymous SNVNM_005121c.G1252Ap.A418T14.61-Yuen2017 G
MED13     09C89982chr17:
60088344-60088344
GAexonicDe novostopgainNM_005121c.C1534Tp.R512X18.75-Satterstrom2020 E
MED13     1-0191-004chr17:
60165901-60165917
GGTCCCTTTTGGACTATGintergenicDe novo--Yuen2017 G
MED13     AU072505chr17:
60090367-60090367
TCintronicDe novo--Yuen2017 G
MED13     1-0985-003chr17:
60086289-60086289
TCintronicDe novo--Yuen2017 G
MED13     AU2433302chr17:
60020023-60020023
TGUTR3De novo--Yuen2017 G
MED13     AU3122301chr17:
60088344-60088344
GAexonicDe novostopgainNM_005121c.C1534Tp.R512X18.75-Yuen2017 G
MED13     1-0191-003chr17:
60136188-60136188
AAGTintronicDe novo--Yuen2017 G
MED13     2-1356-003chr17:
60121428-60121428
GAintronicDe novo--Yuen2016 G
MED13     1-0868-003chr17:
60138804-60138811
TAAAAAAATAAAintronicDe novo--Yuen2017 G
MED13     2-1120-003chr17:
60145720-60145720
CTintergenicDe novo--Yuen2017 G
MED13     13813.p1chr17:
60108956-60108957
AGAexonicDe novoframeshift deletionNM_005121c.857delCp.P286fs--Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
MED13     1-0191-003chr17:
60165901-60165917
GGTCCCTTTTGGACTATGintergenicDe novo--Yuen2017 G
MED13     14450.p1chr17:
60111145-60111145
TCintronicDe novo--Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
MED13     AU4176302chr17:
60248775-60248775
TCintergenicDe novo--Yuen2017 G
MED13     3-0428-000chr17:
60092437-60092437
AGintronicDe novo--Yuen2016 G
Yuen2017 G
MED13     12091.p1chr17:
60057115-60057115
CTintronicDe novo--Werling2018 G
MED13     12235.p1chr17:
60060310-60060319
AGGAGTCCTTAexonicDe novononframeshift deletionNM_005121c.3045_3053delp.1015_1018del-1.657E-5Dong2014 E
Kosmicki2017 E
Satterstrom2020 E
MED13     AU3912303chr17:
60078828-60078828
CTintronicDe novo--Yuen2017 G
MED13     AU4028302chr17:
60142372-60142381
GGGCGCCGGCGGGCGCCGGCGCCGGCintronicDe novo--Yuen2017 G
MED13     1-0547-003chr17:
60290430-60290446
GTATTATTATTATTATTGTATTATTATTATTintergenicDe novo--Yuen2017 G
MED13     2-1579-003chr17:
60084023-60084031
CCTGTCTGTCCTGTintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More