or
or
Exact

Results for "NF1"

Variant Events: 28

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
NF1     5-0015-004chr17:
29680159-29680159
TAintronicDe novo--Yuen2017 G
NF1     AU2756306chr17:
29616842-29616842
TAintronicDe novo--Yuen2017 G
NF1     1-0918-003chr17:
29694990-29694990
TAintronicDe novo--Yuen2017 G
NF1     AU099703chr17:
29548968-29548968
TTTexonicMaternalframeshift insertionNM_001128147c.1742dupTp.L581fs--Zhou2019 T
NF1     11108.p1chr17:
29676099-29676103
TCTTATintronicDe novo-4.137E-5Dong2014 E
Kosmicki2017 E
Satterstrom2020 E
NF1     7-0002-003chr17:
29627262-29627263
CTCintronicDe novo--Yuen2017 G
NF1     AU0452303chr17:
29507773-29507773
GAintronicDe novo--Yuen2017 G
NF1     AU065503chr17:
29548968-29548968
TTTexonicMaternalframeshift insertionNM_001128147c.1742dupTp.L581fs--Zhou2019 T
NF1     010-07-107482chr17:
29661900-29661900
CGexonicDe novononsynonymous SNVNM_000267
NM_001042492
c.C5794G
c.C5857G
p.L1932V
p.L1953V
22.8-Satterstrom2020 E
NF1     AU065403chr17:
29548968-29548968
TTTexonicMaternalframeshift insertionNM_001128147c.1742dupTp.L581fs--Zhou2019 T
NF1     DEASD_1052_001chr17:
29667594-29667594
TAexonicDe novostopgainNM_000267
NM_001042492
c.T6930A
c.T6993A
p.Y2310X
p.Y2331X
27.0-Satterstrom2020 E
NF1     13314.p1chr17:
29460697-29460699
CAGCintronicDe novo--Werling2018 G
NF1     1-0051-004chr17:
29629314-29629314
TCintronicDe novo--Yuen2017 G
NF1     AU1860301chr17:
29456251-29456251
AGintronicDe novo--Yuen2017 G
NF1     AU2215302chr17:
29672736-29672736
AGintronicDe novo--Yuen2017 G
NF1     AU047703chr17:
29691553-29691553
ACintronicDe novo--Yuen2017 G
NF1     AU4219302chr17:
29547287-29547287
CAintronicDe novo--Yuen2017 G
NF1     009-07-107601chr17:
29670026-29670026
GCsplicingDe novosplicing23.0-Satterstrom2020 E
NF1     2-0299-003chr17:
29493176-29493176
AGintronicDe novo--Yuen2017 G
NF1     13882.p1chr17:
29559852-29559852
CGexonicDe novostopgainNM_000267
NM_001042492
c.C3449G
c.C3449G
p.S1150X
p.S1150X
47.0-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
NF1     1-0564-003chr17:
29671593-29671607
TGAGAGAGAGAGAGATGAGAGAGAGAGAintronicDe novo--Yuen2017 G
NF1     11782.p1chr17:
29677317-29677317
CAexonicDe novononsynonymous SNVNM_000267
NM_001042492
c.C7375A
c.C7438A
p.H2459N
p.H2480N
11.17-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Lim2017 E
Sanders2012 E
Wilfert2021 G
NF1     2-1361-003chr17:
29523865-29523865
TCintronicDe novo--Yuen2017 G
NF1     2-1577-003chr17:
29643232-29643232
GAintronicDe novo--Yuen2017 G
NF1     AU4356302chr17:
29626181-29626181
TCintronicDe novo--Yuen2017 G
NF1     TAS_F7056Xchr17:
29562925-29562925
CTintronicDe novo-1.648E-5Satterstrom2020 E
NF1     MT_151chr17:
29684327-29684327
GAexonicPaternalnonsynonymous SNVNM_000267
NM_001042492
c.G7847A
c.G7910A
p.R2616Q
p.R2637Q
25.63.298E-5Toma2013 E
NF1     2-0323-004chr17:
29620236-29620236
TCintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More