or
or
Exact

Results for "YY1"

Variant Events: 10

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
YY1     1-0330-004chr14:
100708665-100708665
AGintronicDe novo--Trost2022 G
Yuen2017 G
YY1     SP0085669chr14:
100743827-100743827
GAexonicDe novononsynonymous SNVNM_003403c.G1135Ap.G379R23.8-Antaki2022 GE
Fu2022 E
Trost2022 G
Zhou2022 GE
YY1     SP0167627chr14:
100741061-100741061
ATexonicDe novononsynonymous SNVNM_003403c.A869Tp.D290V18.95-Trost2022 G
YY1     SP0145763chr14:
100743804-100743804
GAexonicDe novononsynonymous SNVNM_003403c.G1112Ap.R371H26.1-Trost2022 G
YY1     7-0385-003chr14:
100722917-100722917
AGintronicDe novo--Trost2022 G
YY1     1-0190-003chr14:
100727801-100727801
TCintronicDe novo--Trost2022 G
Yuen2017 G
YY1     7-0149-003chr14:
100709169-100709169
TCintronicDe novo--Yuen2017 G
YY1     PN400116chr14:
100706260-100706260
GGATGAAAAAAAAGATATTGACCATGAGACAexonicUnknownframeshift insertionNM_003403c.679_680insATGAAAAAAAAGATATTGACCATGAGACAp.D227fs--Leblond2019 E
YY1     2-1117-003chr14:
100751733-100751733
GTintergenicDe novo--Yuen2016 G
YY1     A4chr14:
100742884-100742884
GAexonicDe novononsynonymous SNVNM_003403c.G961Ap.G321S36.0-Jiao2019 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More