or
or
Exact

Results for "PRKAG2"

Variant Events: 46

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PRKAG2     2-1345-003chr7:
151472301-151472301
GAintronicDe novo--Yuen2017 G
PRKAG2     3-0847-000chr7:
151429945-151429945
AGintronicDe novo--Trost2022 G
PRKAG2     1-0253-004chr7:
151300259-151300291
ACGGAGGGACACGCTCCGTCCTCACCGCACACGAintronicDe novo--Yuen2017 G
PRKAG2     MSSNG00424-004chr7:
151431170-151431170
GAintronicDe novo--Trost2022 G
PRKAG2     AU076704chr7:
151443603-151443603
ACintronicDe novo--Trost2022 G
Yuen2017 G
PRKAG2     5-5015-003chr7:
151400900-151400900
CAintronicDe novo--Trost2022 G
PRKAG2     REACH000724chr7:
151416580-151416580
TCintronicDe novo--Trost2022 G
PRKAG2     AU2463301chr7:
151323611-151323611
GAintronicDe novo--Trost2022 G
PRKAG2     3-0742-000chr7:
151338224-151338224
CTintronicDe novo--Trost2022 G
PRKAG2     MSSNG00136-003chr7:
151303900-151303900
CTintronicDe novo--Trost2022 G
PRKAG2     MSSNG00389-003chr7:
151322230-151322230
TCintronicDe novo--Trost2022 G
PRKAG2     2-0116-004chr7:
151518152-151518155
GGAACCTCintronicDe novo--Trost2022 G
PRKAG2     2-1355-004chr7:
151518152-151518155
GGAACCTCintronicDe novo--Trost2022 G
PRKAG2     2-0116-004chr7:
151518149-151518149
CGintronicDe novo--Trost2022 G
PRKAG2     2-1355-004chr7:
151518149-151518149
CGintronicDe novo--Trost2022 G
PRKAG2     1-0651-003chr7:
151537622-151537622
CTintronicDe novo--Trost2022 G
Yuen2017 G
PRKAG2     A41chr7:
151372597-151372597
GAexonicDe novononsynonymous SNVNM_001304527
NM_001040633
NM_016203
c.C221T
c.C461T
c.C593T
p.P74L
p.P154L
p.P198L
15.688.264E-6Jiao2019 E
PRKAG2     7-0309-004chr7:
151502304-151502304
GAintronicDe novo--Trost2022 G
PRKAG2     1-1044-003chr7:
151504589-151504589
AGintronicDe novo--Trost2022 G
PRKAG2     2-0006-004chr7:
151366854-151366854
GGCAintronicDe novo--Yuen2017 G
PRKAG2     AU2463301chr7:
151442089-151442089
GAintronicDe novo--Trost2022 G
PRKAG2     1-0971-003chr7:
151311792-151311792
CGintronicDe novo--Trost2022 G
Yuen2017 G
PRKAG2     AU2283301chr7:
151473585-151473585
CTintronicDe novo--Trost2022 G
PRKAG2     2-1359-004chr7:
151366864-151366864
TCintronicDe novo--Yuen2017 G
PRKAG2     2-1094-005chr7:
151526739-151526739
GAintronicDe novo--Trost2022 G
PRKAG2     1-1204-004chr7:
151550972-151550973
ACAintronicDe novo--Trost2022 G
PRKAG2     2-1094-005chr7:
151526717-151526721
TTAACTintronicDe novo--Trost2022 G
PRKAG2     2-1094-005chr7:
151526732-151526736
ATAAAGintronicDe novo--Trost2022 G
PRKAG2     2-1134-003chr7:
151568327-151568327
GAintronicDe novo--Yuen2017 G
PRKAG2     2-1140-003chr7:
151305968-151305968
TCintronicDe novo--Yuen2017 G
PRKAG2     2-1186-003chr7:
151527303-151527303
TCintronicDe novo--Yuen2017 G
PRKAG2     1-0092-003chr7:
151518147-151518147
GGAGCCTCCAintronicDe novo--Yuen2017 G
PRKAG2     AU2089301chr7:
151494002-151494002
GAintronicDe novo--Trost2022 G
Yuen2017 G
PRKAG2     2-0214-003chr7:
151548225-151548225
AGintronicDe novo--Trost2022 G
Yuen2017 G
PRKAG2     SP0117452chr7:
151372652-151372652
AGexonicnonsynonymous SNVNM_001304527
NM_001040633
NM_016203
c.T166C
c.T406C
c.T538C
p.Y56H
p.Y136H
p.Y180H
17.27-Zhou2022 GE
PRKAG2     F10209-1chr7:
151372572-151372572
CTexonicDe novosynonymous SNVNM_001304527
NM_001040633
NM_016203
c.G246A
c.G486A
c.G618A
p.P82P
p.P162P
p.P206P
-1.652E-5Fu2022 E
PRKAG2     AU065304chr7:
151308768-151308768
TCintronicDe novo--Trost2022 G
Yuen2017 G
PRKAG2     1-0677-003chr7:
151270167-151270167
CTintronicDe novo--Yuen2017 G
PRKAG2     2-1290-004chr7:
151272216-151272216
TCintronicDe novo--Trost2022 G
Yuen2017 G
PRKAG2     7-0179-003chr7:
151538958-151538975
GGTAGTGATAGTAGTGATGGTAGTGATintronicDe novo--Yuen2017 G
PRKAG2     MSSNG00369-005chr7:
151265996-151265996
TCintronicDe novo--Trost2022 G
PRKAG2     AU3175302 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
PRKAG2     MSSNG00199-003chr7:
151295491-151295491
CTintronicDe novo--Trost2022 G
PRKAG2     SP0014125chr7:
151254461-151254461
TCintronicDe novo--Trost2022 G
PRKAG2     1-0497-003chr7:
151566584-151566584
CTintronicDe novo--Trost2022 G
Yuen2017 G
PRKAG2     2-1736-003chr7:
151518509-151518509
GAintronicDe novo--Trost2022 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More