or
or
Exact

Results for "SYNE1"

Variant Events: 72

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SYNE1     SSC11661chr6:
152647554-152647554
GAexonicDe novononsynonymous SNVNM_033071
NM_182961
c.C14957T
c.C15170T
p.A4986V
p.A5057V
12.16-Fu2022 E
Lim2017 E
SYNE1     AU218Achr6:
152673328-152673328
CTexonicDe novononsynonymous SNVNM_033071
NM_182961
c.G11369A
c.G11414A
p.R3790Q
p.R3805Q
23.6-DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
SYNE1     AC05-0003-01chr6:
152728223-152728223
CTexonicDe novononsynonymous SNVNM_033071
NM_182961
c.G6670A
c.G6649A
p.V2224I
p.V2217I
8.9688.239E-5DeRubeis2014 E
Kosmicki2017 E
Satterstrom2020 E
SYNE1     AU1698302chr6:
152871340-152871343
TAAATAAintronicDe novo--Yuen2017 G
SYNE1     SSC11511chr6:
152673266-152673266
TCexonicDe novononsynonymous SNVNM_033071
NM_182961
c.A11431G
c.A11476G
p.K3811E
p.K3826E
14.55-Fu2022 E
Lim2017 E
SYNE1     3-0661-000chr6:
152697977-152697977
CGexonicDe novononsynonymous SNVNM_033071
NM_182961
c.G9101C
c.G9080C
p.C3034S
p.C3027S
22.7-Yuen2017 G
SYNE1     AU058104chr6:
152800488-152800488
GAintronicDe novo--Yuen2017 G
SYNE1     AU028305chr6:
152910945-152910945
AGintronicDe novo--Yuen2017 G
SYNE1     SP0091993chr6:
152826582-152826582
GAintronicDe novo--Fu2022 E
SYNE1     PN400104chr6:
152464786-152464786
GAexonicUnknownnonsynonymous SNVNM_033071
NM_182961
c.C24947T
c.C25091T
p.P8316L
p.P8364L
34.00.0018Leblond2019 E
SYNE1     SP0003812chr6:
152737444-152737444
TTAintronicDe novo--Fu2022 E
SYNE1     AU3874301chr6:
152730708-152730708
AGexonicDe novononsynonymous SNVNM_033071
NM_182961
c.T6388C
c.T6367C
p.W2130R
p.W2123R
8.761-Yuen2017 G
SYNE1     Codina-Sola2015:ASD_35chr6:
152476160-152476160
CTexonicMaternalnonsynonymous SNVNM_033071
NM_182961
c.G23783A
c.G23996A
p.R7928Q
p.R7999Q
27.82.481E-5Codina-Sola2015 E
SYNE1     SP0052340chr6:
152523011-152523011
TCexonicDe novononsynonymous SNVNM_033071
NM_182961
c.A22880G
c.A23093G
p.Q7627R
p.Q7698R
7.422-Fu2022 E
SYNE1     SP0065049chr6:
152510406-152510406
CTexonicDe novostopgainNM_033071
NM_182961
c.G23069A
c.G23282A
p.W7690X
p.W7761X
50.0-Fu2022 E
SYNE1     AU024607chr6:
152659936-152659936
AGintronicDe novo--Yuen2017 G
SYNE1     SP0033305chr6:
152683493-152683493
TGintronicDe novo--Fu2022 E
SYNE1     1-0265-004chr6:
152615473-152615473
TCintronicDe novo--Yuen2017 G
SYNE1     2K001chr6:
152777063-152777063
CTexonicDe novosynonymous SNVNM_033071
NM_182961
c.G2706A
c.G2685A
p.T902T
p.T895T
-3.296E-5Fu2022 E
Satterstrom2020 E
SYNE1     SP0059540chr6:
152686086-152686086
GAexonicDe novosynonymous SNVNM_033071
NM_182961
c.C10062T
c.C10041T
p.V3354V
p.V3347V
--Fu2022 E
SYNE1     1-0265-003chr6:
152615473-152615473
TCintronicDe novo--Yuen2017 G
SYNE1     Disecmas_232Pchr6:
152737749-152737749
GCexonicDe novononsynonymous SNVNM_033071
NM_182961
c.C5844G
c.C5823G
p.S1948R
p.S1941R
9.239-Fu2022 E
SYNE1     1-0756-004chr6:
152894094-152894097
CCTTCintronicDe novo--Yuen2017 G
SYNE1     12499_p1chr6:
152823811-152823811
TCexonicDe novononsynonymous SNVNM_033071
NM_182961
c.A866G
c.A845G
p.Y289C
p.Y282C
19.57-Fu2022 E
SYNE1     AU0251-0203chr6:
152763209-152763209
CGsplicingDe novosplicing25.9-Fu2022 E
SYNE1     10C108715chr6:
152771947-152771947
GAexonicDe novononsynonymous SNVNM_033071
NM_182961
c.C3229T
c.C3208T
p.P1077S
p.P1070S
14.12-Fu2022 E
SYNE1     11719-1chr6:
152461171-152461171
CGexonicDe novononsynonymous SNVNM_033071
NM_182961
c.G25228C
c.G25372C
p.D8410H
p.D8458H
13.01-Fu2022 E
SYNE1     PN400581chr6:
152665326-152665326
CTexonicUnknownnonsynonymous SNVNM_033071
NM_182961
c.G11902A
c.G12115A
p.V3968I
p.V4039I
25.11.0E-4Leblond2019 E
SYNE1     PN400285chr6:
152806014-152806014
CTexonicUnknownnonsynonymous SNVNM_033071
NM_182961
c.G1162A
c.G1141A
p.D388N
p.D381N
32.00.0012Leblond2019 E
SYNE1     12907.p1chr6:
152776965-152776965
GAintronicMosaic--Dou2017 E
SYNE1     2-1369-003chr6:
152771947-152771947
GAexonicDe novononsynonymous SNVNM_033071
NM_182961
c.C3229T
c.C3208T
p.P1077S
p.P1070S
14.12-Jiang2013 G
Yuen2016 G
Yuen2017 G
SYNE1     1-0022-003chr6:
152444223-152444223
AGintronicDe novo--Yuen2016 G
SYNE1     Viggiano2022:22.4chr6:
152774789-152774789
CTexonicPaternalnonsynonymous SNVNM_033071
NM_182961
c.G2980A
c.G2959A
p.D994N
p.D987N
26.2-Viggiano2022 GT
SYNE1     14485.p1chr6:
152647554-152647554
GAexonicDe novononsynonymous SNVNM_033071
NM_182961
c.C14957T
c.C15170T
p.A4986V
p.A5057V
12.16-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
SYNE1     14490.p1chr6:
152673266-152673266
TCexonicDe novo, Mosaicnonsynonymous SNVNM_033071
NM_182961
c.A11431G
c.A11476G
p.K3811E
p.K3826E
14.55-Dou2017 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
Wilfert2021 G
SYNE1     12499.p1chr6:
152823811-152823811
TCexonicDe novononsynonymous SNVNM_033071
NM_182961
c.A866G
c.A845G
p.Y289C
p.Y282C
19.57-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
SYNE1     14396.p1chr6:
152831363-152831363
CTexonicDe novosynonymous SNVNM_033071
NM_182961
c.G567A
c.G546A
p.K189K
p.K182K
--Iossifov2014 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
SYNE1     13793.p1chr6:
152782817-152782817
GAexonicMosaicnonsynonymous SNVNM_033071
NM_182961
c.C2330T
c.C2309T
p.A777V
p.A770V
18.43-Krupp2017 E
SYNE1     AU1848302chr6:
152675946-152675946
GCexonicDe novononsynonymous SNVNM_033071
NM_182961
c.C10795G
c.C10774G
p.Q3599E
p.Q3592E
11.74-Yuen2017 G
SYNE1     Viggiano2022:22.3chr6:
152774789-152774789
CTexonicPaternalnonsynonymous SNVNM_033071
NM_182961
c.G2980A
c.G2959A
p.D994N
p.D987N
26.2-Viggiano2022 GT
SYNE1     AU2029303chr6:
152462798-152462798
GAintronicDe novo--Yuen2017 G
SYNE1     PN400476chr6:
152651911-152651911
CTexonicUnknownnonsynonymous SNVNM_033071
NM_182961
c.G13696A
c.G13909A
p.D4566N
p.D4637N
19.379.0E-4Leblond2019 E
SYNE1     AU3811305chr6:
152818109-152818109
CTintronicDe novo--Yuen2017 G
SYNE1     60-2027chr6:
152670735-152670735
GAintronicDe novo--Michaelson2012 G
SYNE1     NDAR_INVPV214WLY_wes1chr6:
152640152-152640152
TTAsplicingDe novosplicing-8.436E-6Fu2022 E
Kosmicki2017 E
Satterstrom2020 E
SYNE1     SP0003327chr6:
152599079-152599079
GCintronicDe novo--Fu2022 E
SYNE1     08C77802chr6:
152763403-152763403
TCintronicDe novo--Kosmicki2017 E
Satterstrom2020 E
SYNE1     PN400308chr6:
152540140-152540140
GAexonicUnknownstopgainNM_033071
NM_182961
c.C21829T
c.C22042T
p.Q7277X
p.Q7348X
47.0-Leblond2019 E
SYNE1     2-0149-004chr6:
152806916-152806916
GTintronicDe novo--Yuen2017 G
SYNE1     1-0627-006chr6:
152862296-152862296
TCintronicDe novo--Yuen2017 G
SYNE1     1-0627-006chr6:
152604354-152604354
AGintronicDe novo--Yuen2017 G
SYNE1     1-0261-003chr6:
153017576-153017576
GAintergenicDe novo--Yuen2017 G
SYNE1     5-0073-003chr6:
153016280-153016280
TGintergenicDe novo--Yuen2017 G
SYNE1     1-0570-003chr6:
152834219-152834219
CAintronicDe novo--Yuen2017 G
SYNE1     1-0652-004chr6:
152921362-152921362
CTintronicDe novo--Yuen2017 G
SYNE1     AU046904chr6:
152836590-152836590
TCintronicDe novo--Yuen2017 G
SYNE1     2-0198-003chr6:
152803847-152803847
TCintronicDe novo--Yuen2017 G
SYNE1     5-0129-003chr6:
152903302-152903302
GAintronicDe novo--Yuen2017 G
SYNE1     1-0756-005chr6:
152894094-152894097
CCTTCintronicDe novo--Yuen2017 G
SYNE1     PN400443chr6:
152665326-152665326
CTexonicUnknownnonsynonymous SNVNM_033071
NM_182961
c.G11902A
c.G12115A
p.V3968I
p.V4039I
25.11.0E-4Leblond2019 E
SYNE1     AU-1600chr6:
152690641-152690641
GTexonicInheritednonsynonymous SNVNM_033071
NM_182961
c.C9637A
c.C9616A
p.L3213M
p.L3206M
16.841.648E-5Yu2013 E
SYNE1     AU2029302chr6:
152462798-152462798
GAintronicDe novo--Yuen2017 G
SYNE1     AU0636303chr6:
152987855-152987855
ACintergenicDe novo--Yuen2017 G
SYNE1     14396_p1chr6:
152831363-152831363
CTexonicDe novosynonymous SNVNM_033071
NM_182961
c.G567A
c.G546A
p.K189K
p.K182K
--Fu2022 E
SYNE1     1-0985-003chr6:
152816914-152816914
GAintronicDe novo--Yuen2017 G
SYNE1     Cukier2014:17122chr6:
152779933-152779933
GAexonicUnknownnonsynonymous SNVNM_033071
NM_182961
c.C2548T
c.C2527T
p.R850C
p.R843C
21.70.0251Cukier2014 E
SYNE1     1-0022-004chr6:
152444223-152444223
AGintronicDe novo--Yuen2017 G
SYNE1     233-10-113234chr6:
152751604-152751604
GTintronicDe novo--Satterstrom2020 E
SYNE1     10C109044chr6:
152793462-152793462
AGexonicDe novosynonymous SNVNM_033071
NM_182961
c.T1458C
c.T1437C
p.P486P
p.P479P
--Fu2022 E
Satterstrom2020 E
SYNE1     AU3721302chr6:
152924947-152924961
GTATATATATATATAGTATATATATATATATAintronicDe novo--Yuen2017 G
SYNE1     2-0244-003chr6:
152873969-152873969
TAintronicDe novo--Yuen2017 G
SYNE1     5-0109-003chr6:
152857758-152857758
CTintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More