or
or
Exact

Results for "IL20RB"

Variant Events: 47

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
IL20RB     AU3839302chr3:
137374835-137374835
CTintergenicDe novo--Yuen2017 G
IL20RB     AU3371302chr3:
137075783-137075783
TCintergenicDe novo--Yuen2017 G
IL20RB     1-0186-004chr3:
137000185-137000185
CAintergenicDe novo--Yuen2017 G
IL20RB     1-0265-003chr3:
137285323-137285323
GTintergenicDe novo--Yuen2017 G
IL20RB     2-1112-003chr3:
137332391-137332391
CGintergenicDe novo--Yuen2016 G
Yuen2017 G
IL20RB     1-0092-003chr3:
137069866-137069866
GGTintergenicDe novo--Yuen2017 G
IL20RB     1-0073-003chr3:
137172746-137172746
AGintergenicDe novo--Yuen2017 G
IL20RB     AU072505chr3:
137431652-137431652
GAintergenicDe novo--Yuen2017 G
IL20RB     1-0511-003chr3:
137469868-137469868
GCintergenicDe novo--Yuen2017 G
IL20RB     2-1567-004chr3:
136818994-136818994
AAACCintergenicDe novo--Yuen2017 G
IL20RB     AU3913301chr3:
136909886-136909886
CTintergenicDe novo--Yuen2017 G
IL20RB     1-0380-003chr3:
136741528-136741528
CTintergenicDe novo--Yuen2017 G
IL20RB     A4chr3:
137366275-137366275
CGintergenicDe novo--Wu2018 G
IL20RB     1-0025-004chr3:
137425449-137425449
AACintergenicDe novo--Yuen2017 G
IL20RB     1-0025-006chr3:
137425449-137425449
AACintergenicDe novo--Yuen2017 G
IL20RB     1-0255-003chr3:
137055384-137055384
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
IL20RB     AU3912302chr3:
136898206-136898206
CTintergenicDe novo--Yuen2017 G
IL20RB     1-0075-003chr3:
137239179-137239194
ATCTCTCTCTCTCTCTATCTCTCTCTCTCTintergenicDe novo--Yuen2017 G
IL20RB     2-1592-003chr3:
136951758-136951758
AGintergenicDe novo--Yuen2017 G
IL20RB     5-0021-003chr3:
137030359-137030359
TCintergenicDe novo--Yuen2017 G
IL20RB     1-0638-003chr3:
136741477-136741492
TACACACACACACACATACACACACACACAintergenicDe novo--Yuen2017 G
IL20RB     iHART3040chr3:
136708282-136708282
GAsplicingPaternalsplicing18.847.417E-5Ruzzo2019 G
IL20RB     2-0323-003chr3:
136967203-136967203
CTintergenicDe novo--Yuen2017 G
IL20RB     7-0255-003chr3:
136825834-136825851
AAGAGAGAGAGAGAGAGAAAGAGAGAGAGAGAGAintergenicDe novo--Yuen2017 G
IL20RB     1-0433-004chr3:
137472853-137472853
GAintergenicDe novo--Yuen2017 G
IL20RB     AU3911301chr3:
137036396-137036396
TGintergenicDe novo--Yuen2017 G
IL20RB     08C77595chr3:
136700970-136700970
GCintronicDe novo--Kosmicki2017 E
Satterstrom2020 E
IL20RB     AU4485302chr3:
137381183-137381183
GAintergenicDe novo--Yuen2017 G
IL20RB     2-1154-003chr3:
137474112-137474112
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
IL20RB     AU006804chr3:
136952240-136952240
ATintergenicDe novo--Yuen2017 G
IL20RB     1-0092-004chr3:
137110197-137110197
CCCAATAGCAintergenicDe novo--Yuen2017 G
IL20RB     1-0320-004chr3:
136870610-136870610
GAintergenicDe novo--Yuen2017 G
IL20RB     11356.p1chr3:
136708288-136708288
CGexonicDe novononsynonymous SNVNM_144717c.C412Gp.L138V20.2-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Sanders2012 E
Satterstrom2020 E
Wilfert2021 G
IL20RB     2-1085-004chr3:
137411547-137411547
AGintergenicDe novo--Yuen2017 G
IL20RB     2-1085-004chr3:
137143280-137143280
ATintergenicDe novo--Yuen2017 G
IL20RB     AU003403chr3:
137252571-137252571
GAintergenicDe novo--Yuen2017 G
IL20RB     AU003405chr3:
136965259-136965259
CGintergenicDe novo--Yuen2017 G
IL20RB     13095.p1chr3:
136867480-136867480
CAintergenicMosaic--Dou2017 E
IL20RB     AU011704chr3:
136799487-136799487
CGintergenicDe novo--Yuen2017 G
IL20RB     AU3885304chr3:
137318358-137318358
CTintergenicDe novo--Yuen2017 G
IL20RB     1-0555-003chr3:
136841352-136841352
AGintergenicDe novo--Yuen2017 G
IL20RB     1-0265-004chr3:
137285323-137285323
GTintergenicDe novo--Yuen2017 G
IL20RB     2-1174-006chr3:
137318866-137318866
TAintergenicDe novo--Yuen2017 G
IL20RB     74-0117chr3:
136799487-136799487
CGintergenicDe novo--Michaelson2012 G
IL20RB     1-0652-004chr3:
137099239-137099239
GGAATTintergenicDe novo--Yuen2017 G
IL20RB     2-1591-003chr3:
136793156-136793156
GAintergenicDe novo--Yuen2017 G
IL20RB     AU028305chr3:
136857102-136857102
GAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More