or
or
Exact

Results for "LRP1B"

Variant Events: 233

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
LRP1B     3-0645-000chr2:
141137691-141137691
CTintronicDe novo--Trost2022 G
LRP1B     REACH000544chr2:
141194896-141194896
AGintronicDe novo--Trost2022 G
LRP1B     AU2108302chr2:
143074981-143074981
GAintergenicDe novo--Yuen2017 G
LRP1B     SP0243796chr2:
141135825-141135825
AGexonicDe novononsynonymous SNVNM_018557c.T10562Cp.L3521P15.41-Trost2022 G
LRP1B     AU008505chr2:
141456328-141456328
TCintronicDe novo--Trost2022 G
Yuen2017 G
LRP1B     AU4024303chr2:
142771139-142771139
ATintronicDe novo--Trost2022 G
Yuen2017 G
LRP1B     MSSNG00397-003chr2:
141137599-141137599
GAintronicDe novo--Trost2022 G
LRP1B     2-1764-004chr2:
141118955-141118955
ATintronicDe novo--Trost2022 G
LRP1B     3-0312-000chr2:
141121799-141121799
AGintronicDe novo--Trost2022 G
LRP1B     1-1156-003chr2:
141099586-141099586
CTintronicDe novo--Trost2022 G
LRP1B     2-1764-004chr2:
141118953-141118953
ATintronicDe novo--Trost2022 G
LRP1B     P1225chr2:
141609318-141609318
GAexonicDe novosynonymous SNVNM_018557c.C4614Tp.G1538G--Hashimoto2016 E
LRP1B     2-1749-003chr2:
141387772-141387776
TCTGATintronicDe novo--Trost2022 G
LRP1B     3-0640-000chr2:
141401187-141401187
CTintronicDe novo--Trost2022 G
LRP1B     1-1148-003chr2:
141345761-141345761
CTintronicDe novo--Trost2022 G
LRP1B     SJD_27.3chr2:
141347405-141347405
TAintronicDe novo--Trost2022 G
LRP1B     2-1759-003chr2:
141320364-141320364
TCintronicDe novo--Trost2022 G
LRP1B     2-1109-004chr2:
141321371-141321371
AGintronicDe novo--Trost2022 G
LRP1B     3-0866-000chr2:
141197107-141197107
ATintronicDe novo--Trost2022 G
LRP1B     AU2310301chr2:
141258740-141258740
TGintronicDe novo--Trost2022 G
LRP1B     3-0236-000chr2:
141544008-141544008
AAGTAGGTTintronicDe novo--Trost2022 G
LRP1B     REACH000428chr2:
141546775-141546775
GAintronicDe novo--Trost2022 G
LRP1B     AU005213chr2:
141510040-141510040
CTintronicDe novo--Trost2022 G
LRP1B     3-0236-000chr2:
141544000-141544006
GCCCCTCGintronicDe novo--Trost2022 G
LRP1B     1-1159-003chr2:
141487283-141487283
CTintronicDe novo--Trost2022 G
LRP1B     REACH000697chr2:
141502328-141502328
TCintronicDe novo--Trost2022 G
LRP1B     REACH000559chr2:
141405269-141405269
ACintronicDe novo--Trost2022 G
LRP1B     AU4173301chr2:
142522503-142522503
AGintronicDe novo--Yuen2017 G
LRP1B     1-1090-003chr2:
141487137-141487137
CAintronicDe novo--Trost2022 G
LRP1B     4-0024-003chr2:
141659920-141659920
GTintronicDe novo--Trost2022 G
LRP1B     2-1540-003chr2:
141672744-141672744
AGintronicDe novo--Trost2022 G
LRP1B     1-1183-003chr2:
141622923-141622923
GAintronicDe novo--Trost2022 G
LRP1B     AU2310301chr2:
141636095-141636095
ACintronicDe novo--Trost2022 G
LRP1B     7-0457-003chr2:
141589132-141589132
ATintronicDe novo--Trost2022 G
LRP1B     1-0200-004chr2:
141621005-141621005
CAintronicDe novo--Trost2022 G
LRP1B     AU3782302chr2:
142845319-142845319
CAintronicDe novo--Trost2022 G
Yuen2017 G
LRP1B     2-0733-003chr2:
141555896-141555896
CTintronicDe novo--Trost2022 G
LRP1B     MT_81.3chr2:
141565357-141565357
TCintronicDe novo--Trost2022 G
LRP1B     1-0382-003chr2:
141887153-141887153
CTintronicDe novo--Yuen2017 G
LRP1B     MT_38.3chr2:
141770145-141770145
TCintronicDe novo--Trost2022 G
LRP1B     14496.p1chr2:
141554177-141554177
AGintronicDe novo--Turner2016 G
LRP1B     2-0103-004chr2:
141815793-141815793
GAintronicDe novo--Trost2022 G
LRP1B     2-0139-004chr2:
141744764-141744764
GAintronicDe novo--Trost2022 G
LRP1B     MT_74.3chr2:
141760900-141760900
TCintronicDe novo--Trost2022 G
LRP1B     1-0530-003chr2:
141424599-141424599
GTintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
LRP1B     3-0646-000chr2:
141719082-141719082
AGintronicDe novo--Trost2022 G
LRP1B     4-0082-003chr2:
141721814-141721814
CGintronicDe novo--Trost2022 G
LRP1B     11002.p1chr2:
142233324-142233324
CTintronicDe novo--Turner2016 G
LRP1B     3-0485-000Achr2:
141683772-141683772
CTintronicDe novo--Trost2022 G
LRP1B     11002.p1chr2:
143121720-143121720
ACintergenicDe novo--Turner2016 G
LRP1B     5-0009-003chr2:
141703922-141703922
ACintronicDe novo--Trost2022 G
LRP1B     AU017304chr2:
143498840-143498840
CTintergenicDe novo--Yuen2017 G
LRP1B     MSSNG00432-003chr2:
141894101-141894101
TAintronicDe novo--Trost2022 G
LRP1B     5-5011-003chr2:
141901708-141901708
TAintronicDe novo--Trost2022 G
LRP1B     1-0636-003chr2:
141151222-141151246
CAATAAATAAATAAATAAATAAATACAATAAATAAATAAATAAATAintronicDe novo--Yuen2017 G
LRP1B     AU2310301chr2:
141873163-141873163
CGintronicDe novo--Trost2022 G
LRP1B     MSSNG00432-003chr2:
141894095-141894095
CTintronicDe novo--Trost2022 G
LRP1B     MT_81.3chr2:
141858629-141858629
CGintronicDe novo--Trost2022 G
LRP1B     1-0202-003chr2:
141865918-141865918
TCintronicDe novo--Trost2022 G
LRP1B     1-1201-003chr2:
141850534-141850534
GAintronicDe novo--Trost2022 G
LRP1B     MT_182.4chr2:
141853788-141853788
AGintronicDe novo--Trost2022 G
LRP1B     3-0866-000chr2:
142027118-142027118
GTintronicDe novo--Trost2022 G
LRP1B     AU058105chr2:
143217723-143217723
GCintergenicDe novo--Yuen2017 G
LRP1B     V5T5W_01chr2:
142049474-142049474
CAintronicDe novo--Trost2022 G
LRP1B     2-1212-003chr2:
141206250-141206250
TCintronicDe novo--Trost2022 G
Yuen2017 G
LRP1B     SP0040277chr2:
141528518-141528518
GCexonicDe novononsynonymous SNVNM_018557c.C5558Gp.S1853C28.0-Fu2022 E
Trost2022 G
Zhou2022 GE
LRP1B     MT_12.3chr2:
142001362-142001362
GAintronicDe novo--Trost2022 G
LRP1B     SP0068381chr2:
141283904-141283904
GAexonicDe novononsynonymous SNVNM_018557c.C7778Tp.T2593M12.863.33E-5Fu2022 E
Trost2022 G
Zhou2022 GE
LRP1B     5-5180-003chr2:
142018261-142018261
CTintronicDe novo--Trost2022 G
LRP1B     REACH000558chr2:
141972942-141972942
CTintronicDe novo--Trost2022 G
LRP1B     7-0133-003chr2:
141982034-141982034
GAintronicDe novo--Trost2022 G
LRP1B     5-0003-003chr2:
142713334-142713334
CAintronicDe novo--Trost2022 G
Yuen2017 G
LRP1B     MSSNG00046-003chr2:
141922492-141922492
TCintronicDe novo--Trost2022 G
LRP1B     1-1124-003chr2:
141968912-141968912
CTintronicDe novo--Trost2022 G
LRP1B     1-0554-003chr2:
143574202-143574202
TGintergenicDe novo--Yuen2017 G
LRP1B     2-1357-003chr2:
142212172-142212174
ATTGTAAATACAintronicDe novo--Trost2022 G
LRP1B     2-1357-003chr2:
142212177-142212178
CCTTintronicDe novo--Trost2022 G
LRP1B     MSSNG00222-003chr2:
142193272-142193272
AGintronicDe novo--Trost2022 G
LRP1B     2-1620-003chr2:
142906135-142906135
GCintergenicDe novo--Yuen2017 G
LRP1B     MT_160.4chr2:
142199431-142199431
CAintronicDe novo--Trost2022 G
LRP1B     SP0095463chr2:
141625477-141625477
ACintronicDe novo--Fu2022 E
LRP1B     4-0026-003chr2:
142112241-142112241
GAintronicDe novo--Trost2022 G
LRP1B     SP0078245chr2:
141122181-141122181
TGintronicDe novo--Fu2022 E
LRP1B     1-0191-004chr2:
142114149-142114149
TCCintronicDe novo--Trost2022 G
LRP1B     AU2310301chr2:
142070176-142070176
CCAintronicDe novo--Trost2022 G
LRP1B     AU3900302chr2:
142379652-142379652
GTintronicDe novo--Yuen2017 G
LRP1B     SP0086531chr2:
141707995-141707995
GTintronicDe novo--Fu2022 E
Trost2022 G
LRP1B     MSSNG00367-004chr2:
142081140-142081140
CTintronicDe novo--Trost2022 G
LRP1B     AU004403chr2:
142327082-142327082
AATintronicDe novo--Trost2022 G
LRP1B     2-1807-003chr2:
142334437-142334459
GGTTGTTTTCGAACTCCTGACCTGintronicDe novo--Trost2022 G
LRP1B     4-0064-004chr2:
142278942-142278946
TCCTATintronicDe novo--Trost2022 G
LRP1B     AU000704chr2:
142960194-142960194
TGintergenicDe novo--Yuen2017 G
LRP1B     MSSNG00357-003chr2:
142300574-142300574
CTintronicDe novo--Trost2022 G
LRP1B     MSSNG00354-003chr2:
142220069-142220069
GTintronicDe novo--Trost2022 G
LRP1B     AU2817301chr2:
142263174-142263174
TCintronicDe novo--Trost2022 G
LRP1B     2-0003-003chr2:
142212177-142212178
CCTTintronicDe novo--Trost2022 G
LRP1B     2-1359-004chr2:
142212177-142212178
CCTTintronicDe novo--Trost2022 G
LRP1B     AU031404chr2:
142447213-142447214
CACintronicDe novo--Trost2022 G
Yuen2017 G
LRP1B     AU2310301chr2:
142444902-142444902
CAintronicDe novo--Trost2022 G
LRP1B     2-0057-004chr2:
142171641-142171641
CTintronicDe novo--Trost2022 G
Yuen2017 G
LRP1B     AU046706chr2:
142445774-142445774
TTACintronicDe novo--Trost2022 G
LRP1B     5-0110-003chr2:
142417984-142417984
CAintronicDe novo--Trost2022 G
LRP1B     5-5180-003chr2:
142417987-142417987
GAintronicDe novo--Trost2022 G
LRP1B     AU2988303chr2:
143595487-143595487
CTintergenicDe novo--Yuen2017 G
LRP1B     AU3125301chr2:
142465368-142465368
GAintronicDe novo--Trost2022 G
Yuen2017 G
LRP1B     1-0876-003Achr2:
142372208-142372209
ACAintronicDe novo--Trost2022 G
LRP1B     MSSNG00398-003chr2:
142407007-142407007
CTintronicDe novo--Trost2022 G
LRP1B     3-0309-000chr2:
142348682-142348682
GAintronicDe novo--Trost2022 G
LRP1B     4-0028-003chr2:
142352510-142352510
GAintronicDe novo--Trost2022 G
LRP1B     1-0646-003chr2:
142655558-142655558
TCintronicDe novo--Trost2022 G
LRP1B     AU3720302chr2:
142664068-142664068
GGTintronicDe novo--Trost2022 G
LRP1B     1-0274-004chr2:
142034294-142034294
TCintronicDe novo--Yuen2017 G
LRP1B     1025chr2:
142635947-142635947
CCAintronicDe novo--Trost2022 G
LRP1B     7-0478-003chr2:
142643835-142643835
GAintronicDe novo--Trost2022 G
LRP1B     AU2310301chr2:
142600126-142600126
ACintronicDe novo--Trost2022 G
LRP1B     7-0127-003chr2:
141266555-141266555
GAintronicDe novo--Trost2022 G
Yuen2017 G
LRP1B     5-5159-003chr2:
142618705-142618705
TCintronicDe novo--Trost2022 G
LRP1B     610chr2:
142458972-142458972
AGintronicDe novo--Trost2022 G
LRP1B     3-0719-000chr2:
142481394-142481394
CTintronicDe novo--Trost2022 G
LRP1B     4-0010-003chr2:
142758155-142758155
TCintronicDe novo--Trost2022 G
LRP1B     2-1169-003chr2:
141266418-141266418
CGintronicDe novo--Trost2022 G
Yuen2017 G
LRP1B     2-1237-004chr2:
142783469-142783469
TCintronicDe novo--Trost2022 G
LRP1B     1-1047-003chr2:
142741117-142741117
CTintronicDe novo--Trost2022 G
LRP1B     7-0403-003chr2:
142743181-142743181
AATintronicDe novo--Trost2022 G
LRP1B     AU3912302chr2:
142367828-142367829
TATAAintronicDe novo--Yuen2017 G
LRP1B     REACH000414chr2:
142681780-142681780
CTintronicDe novo--Trost2022 G
LRP1B     7-0365-004chr2:
142698481-142698481
GAintronicDe novo--Trost2022 G
LRP1B     1-0918-003 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
LRP1B     1-0960-003chr2:
142668276-142668277
AGTintronicDe novo--Trost2022 G
LRP1B     1-0960-003chr2:
142668280-142668289
AAACACACCACTAAAATCintronicDe novo--Trost2022 G
LRP1B     5-0128-003chr2:
142694528-142694528
GCintronicDe novo--Trost2022 G
Yuen2017 G
LRP1B     AU055004 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
LRP1B     5-5129-003chr2:
142888307-142888307
CTUTR5De novo-2.472E-5Trost2022 G
LRP1B     7-0324-003chr2:
142850878-142850878
GAintronicDe novo--Trost2022 G
LRP1B     1-0649-003chr2:
142860807-142860807
TCintronicDe novo--Trost2022 G
LRP1B     1-0485-003chr2:
142808222-142808222
AGintronicDe novo--Trost2022 G
Yuen2017 G
LRP1B     REACH000754chr2:
142789928-142789928
CAintronicDe novo--Trost2022 G
LRP1B     4-0062-003chr2:
142844808-142844808
GGAintronicDe novo--Trost2022 G
LRP1B     1-0161-003chr2:
143620700-143620700
TCintergenicDe novo--Yuen2017 G
LRP1B     1-0559-004chr2:
143559865-143559865
GGATintergenicDe novo--Yuen2017 G
LRP1B     2-1251-003chr2:
141449882-141449882
TCintronicDe novo--Trost2022 G
Yuen2017 G
LRP1B     AU4027306chr2:
141057459-141057459
CTintronicDe novo--Trost2022 G
Yuen2017 G
LRP1B     AU3857301chr2:
141737197-141737197
GAintronicDe novo--Trost2022 G
Yuen2017 G
LRP1B     1-0373-003chr2:
143270155-143270155
GAintergenicDe novo--Yuen2017 G
LRP1B     2-0116-005chr2:
143198260-143198260
AGintergenicDe novo--Yuen2017 G
LRP1B     1-0572-003chr2:
142306767-142306767
TCintronicDe novo--Trost2022 G
Yuen2017 G
LRP1B     AU3154301chr2:
142362935-142362935
GAintronicDe novo--Trost2022 G
Yuen2017 G
LRP1B     AU3057301chr2:
141876373-141876373
AGintronicDe novo--Trost2022 G
Yuen2017 G
LRP1B     1-0006-003chr2:
141779287-141779287
AATintronicDe novo--Trost2022 G
Yuen2017 G
LRP1B     AU1987302chr2:
141528712-141528712
GAintronicDe novo--Trost2022 G
Yuen2017 G
LRP1B     2-1345-003chr2:
142163904-142163904
GAintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
LRP1B     2-0208-004chr2:
141720134-141720134
GGCTCCTCTTCAGAintronicDe novo--Yuen2017 G
LRP1B     2-1146-003chr2:
141595275-141595275
CTintronicDe novo--Trost2022 G
Yuen2017 G
LRP1B     1-0638-003chr2:
142270214-142270214
TCintronicDe novo--Trost2022 G
Yuen2017 G
LRP1B     2-0208-004chr2:
143237802-143237802
CTintergenicDe novo--Yuen2017 G
LRP1B     AU3610302chr2:
143364441-143364441
AGintergenicDe novo--Yuen2017 G
LRP1B     2-1338-003chr2:
143490534-143490534
CGintergenicDe novo--Yuen2017 G
LRP1B     2-1338-003chr2:
142880293-142880293
CTintronicDe novo--Trost2022 G
Yuen2017 G
LRP1B     2-1094-005chr2:
143020418-143020418
AGintergenicDe novo--Yuen2017 G
LRP1B     1-0656-003chr2:
143314582-143314582
GAintergenicDe novo--Yuen2017 G
LRP1B     5-0129-003chr2:
143580017-143580017
ATintergenicDe novo--Yuen2017 G
LRP1B     PN400484chr2:
141812787-141812788
CTCexonicUnknownframeshift deletionNM_018557c.1449delAp.P483fs--Leblond2019 E
LRP1B     1-0139-003chr2:
142948743-142948743
GAintergenicDe novo--Yuen2017 G
LRP1B     2-1178-003chr2:
143254109-143254109
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
LRP1B     1-0383-003chr2:
141848980-141848980
CGintronicDe novo--Trost2022 G
Yuen2017 G
LRP1B     A32chr2:
142409188-142409188
CTintronicDe novo--Wu2018 G
LRP1B     1-0736-003chr2:
141966163-141966169
CGGGGGGCGGGGGGGintronicDe novo--Yuen2017 G
LRP1B     7-0129-003chr2:
141280649-141280649
CGintronicDe novo--Trost2022 G
Yuen2017 G
LRP1B     08C75365chr2:
141083302-141083302
ACintronicDe novo-8.383E-6Satterstrom2020 E
Trost2022 G
LRP1B     1-0871-003chr2:
143104863-143104863
AGintergenicDe novo--Yuen2017 G
LRP1B     2-1635-004chr2:
143327651-143327651
ACintergenicDe novo--Yuen2017 G
LRP1B     2-1690-003chr2:
141632212-141632212
GTintronicDe novo--Yuen2017 G
LRP1B     A18chr2:
142586519-142586519
CTintronicDe novo--Wu2018 G
LRP1B     AU4150301chr2:
142917727-142917727
ATintergenicDe novo--Yuen2017 G
LRP1B     12026.p1chr2:
141812731-141812731
GAexonicMosaic Mat.synonymous SNVNM_018557c.C1506Tp.R502R--Dou2017 E
LRP1B     A18chr2:
142588059-142588059
CTintronicDe novo--Wu2018 G
LRP1B     2-0012-004chr2:
141348790-141348790
CTintronicDe novo--Trost2022 G
Yuen2017 G
LRP1B     A26chr2:
143620099-143620099
CTintergenicDe novo--Wu2018 G
LRP1B     AU4186302chr2:
142301941-142301942
TCTintronicDe novo--Yuen2017 G
LRP1B     1-0125-003chr2:
142476674-142476674
AGintronicDe novo--Trost2022 G
Yuen2017 G
LRP1B     AU3811305chr2:
141494052-141494052
CTintronicDe novo--Trost2022 G
Yuen2017 G
LRP1B     1-0299-004chr2:
142903744-142903744
ACintergenicDe novo--Yuen2017 G
LRP1B     2-1112-003chr2:
142484307-142484307
ATintronicDe novo--Yuen2017 G
LRP1B     1-0935-003chr2:
143170737-143170737
AGintergenicDe novo--Yuen2017 G
LRP1B     2-1454-003chr2:
141598094-141598094
AGintronicDe novo--Trost2022 G
Yuen2017 G
LRP1B     1-0277-003chr2:
141928045-141928045
GCintronicDe novo--Yuen2016 G
Yuen2017 G
LRP1B     AU4231301chr2:
142996126-142996126
GTintergenicDe novo--Yuen2017 G
LRP1B     AU4372309chr2:
141080488-141080488
AGintronicDe novo--Trost2022 G
Yuen2017 G
LRP1B     AU1542301chr2:
142825401-142825401
TCintronicDe novo--Trost2022 G
Yuen2017 G
LRP1B     11977.p1chr2:
141093437-141093437
TCintronicDe novo--Satterstrom2020 E
LRP1B     AU3645301chr2:
143459816-143459816
TCintergenicDe novo--Yuen2017 G
LRP1B     5-0055-004chr2:
141989223-141989223
AGintronicDe novo--Trost2022 G
Yuen2017 G
LRP1B     5-0055-004chr2:
142576307-142576307
GAintronicDe novo--Trost2022 G
Yuen2017 G
LRP1B     5-0018-003chr2:
141245224-141245224
GAexonicDe novononsynonymous SNVNM_018557c.C9205Tp.R3069C20.11.655E-5Trost2022 G
Yuen2017 G
Zhou2022 GE
LRP1B     2-1461-003chr2:
142245141-142245141
TCintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
LRP1B     5-0050-003chr2:
141742359-141742364
GTTCTAGintronicDe novo--Trost2022 G
Yuen2017 G
LRP1B     1-0300-003chr2:
141179957-141179957
AGintronicDe novo--Trost2022 G
Yuen2017 G
LRP1B     AU4188302chr2:
143283088-143283088
CTintergenicDe novo--Yuen2017 G
LRP1B     11459.p1chr2:
141291600-141291600
TCexonicMosaicsynonymous SNVNM_018557c.A7752Gp.L2584L--Dou2017 E
Krupp2017 E
LRP1B     AU3634301chr2:
143545759-143545759
GAintergenicDe novo--Yuen2017 G
LRP1B     2-1480-003chr2:
141906763-141906764
TGTintronicDe novo--Yuen2017 G
LRP1B     AU4273304chr2:
141567017-141567017
CTintronicDe novo--Trost2022 G
Yuen2017 G
LRP1B     2-0182-003chr2:
142790627-142790627
CAintronicDe novo--Yuen2017 G
LRP1B     1-0210-004chr2:
141735636-141735636
TCintronicDe novo--Yuen2017 G
LRP1B     2-1455-003chr2:
142278851-142278851
AGintronicDe novo--Yuen2016 G
LRP1B     1-0024-003chr2:
143407052-143407052
AGintergenicDe novo--Yuen2017 G
LRP1B     2-0704-003chr2:
142926730-142926730
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
LRP1B     1-0912-003chr2:
142127452-142127452
AGintronicDe novo--Trost2022 G
Yuen2017 G
LRP1B     AU060703chr2:
143413224-143413226
CATCintergenicDe novo--Yuen2017 G
LRP1B     AU2495301chr2:
141652997-141652997
CTintronicDe novo--Trost2022 G
Yuen2017 G
LRP1B     A218803chr2:
141128301-141128301
AGexonicDe novosynonymous SNVNM_018557c.T10986Cp.S3662S--Fu2022 E
LRP1B     DEASD_2002_002chr2:
141200135-141200135
GAexonicDe novononsynonymous SNVNM_018557c.C10352Tp.S3451F33.0-Fu2022 E
LRP1B     AU3861301chr2:
142808393-142808393
ACintronicDe novo--Trost2022 G
Yuen2017 G
LRP1B     AU3779304chr2:
141208137-141208137
GAexonicDe novononsynonymous SNVNM_018557c.C10057Tp.P3353S28.82.478E-5Trost2022 G
Yuen2017 G
Zhou2022 GE
LRP1B     1-0321-004chr2:
142946790-142946791
GCGintergenicDe novo--Yuen2017 G
LRP1B     AU4250301chr2:
141276433-141276433
CTintronicDe novo--Trost2022 G
Yuen2017 G
LRP1B     AU2793302chr2:
142038923-142038923
GCintronicDe novo--Yuen2017 G
LRP1B     1-0345-003chr2:
142946779-142946781
CCTCintergenicDe novo--Yuen2017 G
LRP1B     1-0991-003chr2:
141095206-141095206
GAintronicDe novo--Yuen2017 G
LRP1B     1-0518-003chr2:
141587070-141587070
TAintronicDe novo--Yuen2017 G
LRP1B     1-0274-003chr2:
142034294-142034294
TCintronicDe novo--Yuen2017 G
LRP1B     7-0174-003chr2:
141092773-141092788
ATGTGTGTGTGTGTGTATGTGTGTGTGTGTintronicDe novo--Yuen2017 G
LRP1B     AU3790302chr2:
141676046-141676046
AGintronicDe novo--Trost2022 G
Yuen2017 G
LRP1B     7-0223-003chr2:
141616816-141616816
CAintronicDe novo--Trost2022 G
Yuen2017 G
LRP1B     2-0007-003chr2:
141283080-141283080
TAintronicDe novo--Trost2022 G
Yuen2017 G
LRP1B     MSSNG00197-003chr2:
141069236-141069241
CAAATACintronicDe novo--Trost2022 G
LRP1B     SSC03765chr2:
141093437-141093437
TCintronicDe novo--Trost2022 G
LRP1B     2-1235-003chr2:
141057561-141057561
CAintronicDe novo--Trost2022 G
LRP1B     2-1235-003chr2:
141057564-141057568
GTGTGTGATAintronicDe novo--Trost2022 G
LRP1B     7-0365-004chr2:
141017262-141017273
TACATAAATCAGTintronicDe novo--Trost2022 G
LRP1B     5-1003-003chr2:
141052321-141052321
CTintronicDe novo--Trost2022 G
LRP1B     2-1485-004chr2:
143619736-143619736
CAintergenicDe novo--Yuen2017 G
LRP1B     SP0161248chr2:
140990855-140990855
AGexonicDe novononsynonymous SNVNM_018557c.T13700Cp.M4567T12.828.385E-6Trost2022 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More