or
or
Exact

Results for "ARSJ"

Variant Events: 27

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ARSJ     2-1461-003chr4:
115380030-115380030
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
ARSJ     AU3517302chr4:
115228989-115228989
AGintergenicDe novo--Yuen2017 G
ARSJ     1-0099-003chr4:
115389888-115389888
TGintergenicDe novo--Yuen2017 G
ARSJ     1-0073-003chr4:
114956158-114956158
TCintergenicDe novo--Yuen2017 G
ARSJ     7-0143-003chr4:
114926091-114926091
GAintergenicDe novo--Yuen2017 G
ARSJ     1-0169-003chr4:
115477001-115477001
GAintergenicDe novo--Yuen2017 G
ARSJ     5-0129-003chr4:
115453767-115453767
TCintergenicDe novo--Yuen2017 G
ARSJ     2-1407-003chr4:
115052204-115052204
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
ARSJ     1-0446-003chr4:
115326431-115326441
AGCTGTGACTGAintergenicDe novo--Yuen2017 G
ARSJ     1-0417-003chr4:
115459637-115459637
TGintergenicDe novo--Yuen2016 G
Yuen2017 G
ARSJ     3-0307-000chr4:
115009477-115009477
CTintergenicDe novo--Yuen2017 G
ARSJ     AU2458302chr4:
115386290-115386290
ATintergenicDe novo--Yuen2017 G
ARSJ     AU2427302chr4:
114911319-114911319
GAintergenicDe novo--Yuen2017 G
ARSJ     1-0539-003chr4:
115455542-115455542
GAintergenicDe novo--Yuen2017 G
ARSJ     AU4246304chr4:
114912645-114912645
CTintergenicDe novo--Yuen2017 G
ARSJ     2-1619-003chr4:
115152287-115152287
AAGATGintergenicDe novo--Yuen2017 G
ARSJ     5-0111-003chr4:
115341103-115341103
CTintergenicDe novo--Yuen2017 G
ARSJ     AU4233301chr4:
114999569-114999583
TAAGAAGAAGAAGAATAAGAAGAAGAAintergenicDe novo--Yuen2017 G
ARSJ     AU061104chr4:
114842144-114842144
AGintronicDe novo--Yuen2017 G
ARSJ     AU1909304chr4:
115170511-115170511
AGintergenicDe novo--Yuen2017 G
ARSJ     MT_69chr4:
114824312-114824312
GCexonicMaternalnonsynonymous SNVNM_024590c.C918Gp.N306K15.12-Toma2013 E
ARSJ     AU3808305chr4:
115228318-115228318
TCintergenicDe novo--Yuen2017 G
ARSJ     AU3702307chr4:
115304918-115304918
GAintergenicDe novo--Yuen2017 G
ARSJ     2-0309-005chr4:
115241563-115241563
TCintergenicDe novo--Yuen2017 G
ARSJ     1-0636-003chr4:
115459127-115459127
AGintergenicDe novo--Yuen2017 G
ARSJ     1-0906-003chr4:
115108739-115108739
GAintergenicDe novo--Yuen2017 G
ARSJ     1-0547-003chr4:
115391081-115391081
CTintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More