or
or
Exact

Results for "TECTA"

Variant Events: 28

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
TECTA     09C87450chr11:
120996340-120996340
CTexonicDe novosynonymous SNVNM_005422c.C1533Tp.D511D--DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
TECTA     NDAR_INVJT291VPH_wes1chr11:
120998556-120998556
GAexonicDe novononsynonymous SNVNM_005422c.G1870Ap.A624T9.515-DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
TECTA     PN400548chr11:
121008480-121008480
GAexonicUnknownnonsynonymous SNVNM_005422c.G3292Ap.A1098T32.01.648E-5Leblond2019 E
TECTA     1-0566-003chr11:
121002947-121002947
AGintronicDe novo--Yuen2017 G
TECTA     2-1281-003chr11:
121123903-121123903
CAintergenicDe novo--Yuen2017 G
TECTA     13618.p1chr11:
121039453-121039453
GAexonicMosaic, De novononsynonymous SNVNM_005422c.G5818Ap.A1940T19.631.647E-5Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
TECTA     14540.p1 Complex Event; expand row to view variants  De novoframeshift insertionNM_005422
NM_005422
c.6273_6274insGGAG
c.6274_6275insGGAG
p.N2091fs
p.G2092fs
--Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
TECTA     1-0568-003chr11:
121087209-121087209
GAintergenicDe novo--Yuen2017 G
TECTA     1483JS0007chr11:
120989131-120989131
GAexonicDe novononsynonymous SNVNM_005422c.G907Ap.E303K35.04.119E-5Lim2017 E
TECTA     2-1223-003chr11:
121133978-121133978
GAintergenicDe novo--Yuen2017 G
TECTA     SSC09139chr11:
121039453-121039453
GAexonicMosaicnonsynonymous SNVNM_005422c.G5818Ap.A1940T19.631.647E-5Lim2017 E
TECTA     206-04-100546chr11:
121008709-121008709
GAexonicDe novononsynonymous SNVNM_005422c.G3521Ap.R1174Q21.85.07E-5Satterstrom2020 E
TECTA     5-0015-003chr11:
121095238-121095238
TCintergenicDe novo--Yuen2017 G
TECTA     12163.p1chr11:
121039588-121039588
ACexonicDe novononsynonymous SNVNM_005422c.A5953Cp.T1985P14.41-Satterstrom2020 E
TECTA     PN400546chr11:
121008480-121008480
GAexonicUnknownnonsynonymous SNVNM_005422c.G3292Ap.A1098T32.01.648E-5Leblond2019 E
TECTA     PN400533chr11:
121008480-121008480
GAexonicUnknownnonsynonymous SNVNM_005422c.G3292Ap.A1098T32.01.648E-5Leblond2019 E
TECTA     2-1322-003chr11:
121056119-121056119
CCAGATGTTGAATGCTTAATGAATGAGTAGGGAAAGAintronicDe novo--Yuen2017 G
TECTA     AU4283301chr11:
121047704-121047704
GAintronicDe novo--Yuen2017 G
TECTA     iHART2681chr11:
121016805-121016805
GAexonicPaternalstopgainNM_005422c.G4085Ap.W1362X42.03.473E-5Ruzzo2019 G
TECTA     iHART2682chr11:
121016805-121016805
GAexonicPaternalstopgainNM_005422c.G4085Ap.W1362X42.03.473E-5Ruzzo2019 G
TECTA     AU056005chr11:
121159949-121159949
GAintergenicDe novo--Yuen2017 G
TECTA     2-0002-005chr11:
121156133-121156133
GAintergenicDe novo--Yuen2017 G
TECTA     SJD_34chr11:
121028796-121028796
CTexonicMaternalstopgainNM_005422c.C4552Tp.Q1518X44.0-Toma2013 E
TECTA     2-1361-003chr11:
121139952-121139952
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
TECTA     AU4072303chr11:
121157268-121157268
ATintergenicDe novo--Yuen2017 G
TECTA     5-0123-003chr11:
121045799-121045799
TGintronicDe novo--Yuen2017 G
TECTA     AU4223302chr11:
121146445-121146445
CTintergenicDe novo--Yuen2017 G
TECTA     PN400544chr11:
121008480-121008480
GAexonicUnknownnonsynonymous SNVNM_005422c.G3292Ap.A1098T32.01.648E-5Leblond2019 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More