or
or
Exact

Results for "SNTG2"

Variant Events: 29

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SNTG2     1-0455-003chr2:
1194838-1194841
ATCCAintronicDe novo--Yuen2017 G
SNTG2     1-0384-003chr2:
1193608-1193608
GAintronicDe novo--Yuen2017 G
SNTG2     2-0320-003chr2:
975718-975718
AGintronicDe novo--Yuen2017 G
SNTG2     AU3051303chr2:
1150678-1150678
AGintronicDe novo--Yuen2017 G
SNTG2     AU4483301chr2:
976222-976226
CTTTTCTTTintronicDe novo--Yuen2017 G
SNTG2     AU4483301chr2:
976252-976276
TACAATGATTTCTACAGAGCTCACATACAintronicDe novo--Yuen2017 G
SNTG2     AU3811301chr2:
1111963-1111963
TCintronicDe novo--Yuen2017 G
SNTG2     2-0182-003chr2:
1146929-1146929
GGGGTGTintronicDe novo--Yuen2017 G
SNTG2     2-1579-003chr2:
1391831-1391831
CTintergenicDe novo--Yuen2017 G
SNTG2     7-0148-003chr2:
1391742-1391742
GAintergenicDe novo--Yuen2017 G
SNTG2     2-1237-003chr2:
1217079-1217084
GTCTCTGTCTCTCTCTintronicDe novo--Yuen2017 G
SNTG2     5-0131-003chr2:
1283750-1283750
CTintronicDe novo--Yuen2017 G
SNTG2     AU3398301chr2:
1040748-1040748
AGintronicDe novo--Yuen2017 G
SNTG2     2-1283-003chr2:
1200641-1200641
AGintronicDe novo--Yuen2017 G
SNTG2     2-1283-003chr2:
1146929-1146929
GGGGTGTintronicDe novo--Yuen2017 G
SNTG2     2-1352-003chr2:
1385618-1385618
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
SNTG2     iHART2536chr2:
1271332-1271332
CTexonicPaternalstopgainNM_018968c.C1273Tp.Q425X31.0-Ruzzo2019 G
SNTG2     1-0509-003chr2:
963071-963071
AGintronicDe novo--Yuen2017 G
SNTG2     SJD_34chr2:
1271174-1271174
TCexonicMaternalnonsynonymous SNVNM_018968c.T1115Cp.L372S13.32-Toma2013 E
SNTG2     1-0483-003chr2:
1041359-1041359
TCintronicDe novo--Yuen2016 G
Yuen2017 G
SNTG2     2-1255-003chr2:
1218253-1218256
CTGTCTintronicDe novo--Yuen2017 G
SNTG2     2-1317-003chr2:
1218253-1218256
CTGTCTintronicDe novo--Yuen2017 G
SNTG2     2-0219-004chr2:
1324772-1324772
AGintronicDe novo--Yuen2017 G
SNTG2     1-0652-004chr2:
1139393-1139393
TTAAAAAAAAAAintronicDe novo--Yuen2017 G
SNTG2     2-1089-004chr2:
1341372-1341372
AGintronicDe novo--Yuen2017 G
SNTG2     AU3053301chr2:
978297-978297
CTintronicDe novo--Yuen2017 G
SNTG2     2-1283-004chr2:
1200641-1200641
AGintronicDe novo--Yuen2017 G
SNTG2     1-0495-003chr2:
1342234-1342234
ATintronicDe novo--Yuen2017 G
SNTG2     1-0368-004chr2:
1255574-1255574
AACGintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More