or
or
Exact

Results for "ZFHX3"

Variant Events: 34

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ZFHX3     P1204chr16:
72845532-72845532
GAexonicDe novononsynonymous SNVNM_001164766
NM_006885
c.C1066T
c.C3808T
p.H356Y
p.H1270Y
20.2-Hashimoto2016 E
ZFHX3     1-0246-004chr16:
73037474-73037474
GAintronicDe novo--Yuen2017 G
ZFHX3     2-0012-004chr16:
73118223-73118223
AGintergenicDe novo--Yuen2017 G
ZFHX3     5-0033-004chr16:
72830569-72830569
GAexonicDe novosynonymous SNVNM_001164766
NM_006885
c.C3270T
c.C6012T
p.H1090H
p.H2004H
-8.271E-6Yuen2017 G
ZFHX3     AU3912301chr16:
72861026-72861026
AGintronicDe novo--Yuen2017 G
ZFHX3     1-0652-004chr16:
72916235-72916235
CTintronicDe novo--Yuen2017 G
ZFHX3     SSC09647chr16:
72991513-72991513
GTexonicDe novononsynonymous SNVNM_006885c.C2532Ap.H844Q10.86-Lim2017 E
ZFHX3     G01-GEA-42-HIchr16:
72821378-72821378
GAexonicDe novosynonymous SNVNM_001164766
NM_006885
c.C8055T
c.C10797T
p.P2685P
p.P3599P
--Lim2017 E
ZFHX3     AU4343302chr16:
72921869-72921869
CTintronicDe novo--Yuen2017 G
ZFHX3     1-0671-003chr16:
72976934-72976934
GCintronicDe novo--Yuen2017 G
ZFHX3     NDAR_INVFD105FB0_wes1chr16:
72984913-72984913
CTintronicDe novo-9.084E-6Kosmicki2017 E
Satterstrom2020 E
ZFHX3     233-10-113234chr16:
72832575-72832575
CTexonicDe novononsynonymous SNVNM_001164766
NM_006885
c.G1264A
c.G4006A
p.A422T
p.A1336T
6.6191.7E-5Satterstrom2020 E
ZFHX3     1-0901-004chr16:
72984616-72984616
GAexonicDe novononsynonymous SNVNM_001164766
NM_006885
c.C226T
c.C2968T
p.R76C
p.R990C
17.023.0E-4Yuen2017 G
ZFHX3     AU1725302chr16:
72906506-72906506
GAintronicDe novo--Yuen2017 G
ZFHX3     AU3703302chr16:
72960645-72960645
GAintronicDe novo--Yuen2017 G
ZFHX3     SJD_50chr16:
72821344-72821344
GAexonicMaternalnonsynonymous SNVNM_001164766
NM_006885
c.C8089T
c.C10831T
p.H2697Y
p.H3611Y
5.0290.0079Toma2013 E
ZFHX3     7-0067-003chr16:
73048815-73048815
TCintronicDe novo--Yuen2017 G
ZFHX3     14486.p1 Complex Event; expand row to view variants  De novoframeshift insertionNM_001164766
NM_006885
NM_001164766
NM_006885
c.2115dupA
c.4857dupA
c.2115dupA
c.4857dupA
p.H706fs
p.H1620fs
p.L705fs
p.L1619fs
--Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
ZFHX3     14033.p1chr16:
72991513-72991513
GTexonicDe novononsynonymous SNVNM_006885c.C2532Ap.H844Q10.86-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
ZFHX3     13171.p1chr16:
73073324-73073324
ACintronicDe novo--Turner2016 G
ZFHX3     13062.p1chr16:
72992621-72992630
TCCTCCTCCGTexonicDe novononframeshift deletionNM_006885c.1415_1423delp.472_475del--Iossifov2014 E
Kosmicki2017 E
ZFHX3     2-1089-003chr16:
72989504-72989504
CTintronicDe novo--Yuen2017 G
ZFHX3     AU3517301chr16:
72991360-72991360
GAexonicDe novosynonymous SNVNM_006885c.C2685Tp.P895P-1.67E-5Satterstrom2020 E
Yuen2017 G
ZFHX3     1-0162-004chr16:
72884388-72884388
AGintronicDe novo--Yuen2017 G
ZFHX3     2-0068-003chr16:
73048302-73048302
CTintronicDe novo--Yuen2017 G
ZFHX3     1-0375-003chr16:
72915066-72915066
GAintronicDe novo--Yuen2016 G
Yuen2017 G
ZFHX3     10C109061chr16:
72845633-72845633
TCexonicDe novononsynonymous SNVNM_001164766
NM_006885
c.A965G
c.A3707G
p.N322S
p.N1236S
17.512.479E-5Satterstrom2020 E
ZFHX3     SP0007272chr16:
72991377-72991377
CTexonicMosaicnonsynonymous SNVNM_006885c.G2668Ap.G890R17.918.278E-6Feliciano2019 E
ZFHX3     AU4183301chr16:
73022110-73022110
CTintronicDe novo--Yuen2017 G
ZFHX3     2-1381-003chr16:
72845633-72845633
TCexonicDe novononsynonymous SNVNM_001164766
NM_006885
c.A965G
c.A3707G
p.N322S
p.N1236S
17.512.479E-5Yuen2017 G
ZFHX3     1-0579-003chr16:
73105355-73105377
TCTGCTGCTGCTGCTGCTGCTGCTCTGCTGCTGCTGCTGCTGCintergenicDe novo--Yuen2017 G
ZFHX3     AU246Achr16:
72991675-72991675
GAexonicDe novosynonymous SNVNM_006885c.C2370Tp.C790C-1.655E-5DeRubeis2014 E
Kosmicki2017 E
Satterstrom2020 E
ZFHX3     2-0012-003chr16:
73096144-73096144
CTintergenicDe novo--Yuen2017 G
ZFHX3     1-0300-004chr16:
73008205-73008205
CTintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More