or
or
Exact

Results for "NRG1"

Variant Events: 85

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
NRG1     AU3175303chr8:
33042430-33042430
TAintergenicDe novo--Yuen2017 G
NRG1     AU3777302chr8:
31731225-31731225
TCintronicDe novo--Yuen2017 G
NRG1     AU4219302chr8:
32184402-32184402
GAintronicDe novo--Yuen2017 G
NRG1     AU4219302chr8:
32949301-32949301
CTintergenicDe novo--Yuen2017 G
NRG1     2-1346-003chr8:
31740016-31740016
AGintronicDe novo--Yuen2016 G
Yuen2017 G
NRG1     AU4314302chr8:
33053391-33053391
GAintergenicDe novo--Yuen2017 G
NRG1     2-0309-005chr8:
32991776-32991776
ACintergenicDe novo--Yuen2017 G
NRG1     3-0447-000chr8:
32952755-32952755
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
NRG1     AU3937301chr8:
32115034-32115034
GAintronicDe novo--Yuen2017 G
NRG1     AU2075302chr8:
31746553-31746553
AGintronicDe novo--Yuen2017 G
NRG1     1-0259-003chr8:
32576964-32576964
CAintronicDe novo--Yuen2017 G
NRG1     7-0223-003chr8:
33193865-33193865
CTintergenicDe novo--Yuen2017 G
NRG1     2-0295-003chr8:
32703539-32703539
TCintergenicDe novo--Yuen2017 G
NRG1     2-0295-003chr8:
32643005-32643005
TTCACintergenicDe novo--Yuen2017 G
NRG1     1-0971-003chr8:
32085345-32085350
CAAAAACAAAAintronicDe novo--Yuen2017 G
NRG1     AU3634301chr8:
32609634-32609634
AGintronicDe novo--Yuen2017 G
NRG1     3-0018-000chr8:
32382550-32382550
GAintronicDe novo--Yuen2017 G
NRG1     7-0100-004chr8:
33009601-33009601
GAintergenicDe novo--Yuen2017 G
NRG1     2-1425-004chr8:
32328103-32328103
CGintronicDe novo--Yuen2017 G
NRG1     AU4452302chr8:
33124121-33124121
GAintergenicDe novo--Yuen2017 G
NRG1     1-0255-003chr8:
33064482-33064482
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
NRG1     2-1486-003chr8:
32350738-32350739
ACAintronicDe novo--Yuen2016 G
Yuen2017 G
NRG1     AU2139305chr8:
31621739-31621739
ATintronicDe novo--Yuen2017 G
NRG1     AU4072303chr8:
32902480-32902480
GTintergenicDe novo--Yuen2017 G
NRG1     AU3763305chr8:
32529934-32529934
GAintronicDe novo--Yuen2017 G
NRG1     AU3840302chr8:
32356927-32356927
GAintronicDe novo--Yuen2017 G
NRG1     2-1163-003chr8:
32717680-32717680
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
NRG1     AU4310301chr8:
33110039-33110039
AGintergenicDe novo--Yuen2017 G
NRG1     2-1525-003chr8:
31868610-31868610
ATintronicDe novo--Yuen2017 G
NRG1     AU1542303chr8:
32124905-32124905
ATintronicDe novo--Yuen2017 G
NRG1     AU4239301chr8:
32749062-32749069
CAGTTAGTCAGTintergenicDe novo--Yuen2017 G
NRG1     3-0209-000chr8:
33141700-33141700
GAintergenicDe novo--Yuen2017 G
NRG1     12449.p1chr8:
31540489-31540489
CTintronicDe novo--Turner2016 G
NRG1     AU026604chr8:
32116132-32116147
TGAGAGAGAGAGAGAGTGAGAGAGAGAGAGAGAGintronicDe novo--Yuen2017 G
NRG1     1-0231-004chr8:
32187163-32187163
CTintronicDe novo--Yuen2017 G
NRG1     13515.p1chr8:
33008704-33008704
CAintergenicDe novo--Turner2016 G
NRG1     1-0524-003chr8:
32430180-32430180
AGintronicDe novo--Yuen2016 G
Yuen2017 G
NRG1     1-0215-006chr8:
31811029-31811029
GAintronicDe novo--Yuen2017 G
NRG1     14642.p1chr8:
31756475-31756475
GTintronicDe novo--Turner2016 G
NRG1     12011.p1chr8:
33005584-33005584
GAintergenicDe novo--Turner2016 G
NRG1     AU1355301chr8:
32657761-32657761
TCintergenicDe novo--Yuen2017 G
NRG1     AU073005chr8:
31668988-31668995
ATTTTTTTATTTTTTTTintronicDe novo--Yuen2017 G
NRG1     2-0303-004chr8:
31700857-31700857
CTintronicDe novo--Yuen2017 G
NRG1     1-0248-003chr8:
31713091-31713091
GAintronicDe novo--Yuen2017 G
NRG1     AU3777301chr8:
31596616-31596616
CTintronicDe novo--Yuen2017 G
NRG1     A10chr8:
33047537-33047537
TAintergenicDe novo--Wu2018 G
NRG1     SJD_49chr8:
32617875-32617875
CGexonicPaternalnonsynonymous SNVNM_001159996
NM_001160004
NM_001160008
NM_013957
NM_013960
NM_013964
NM_013956
c.C757G
c.C1210G
c.C1210G
c.C1210G
c.C1219G
c.C1219G
c.C1234G
p.H253D
p.H404D
p.H404D
p.H404D
p.H407D
p.H407D
p.H412D
19.28.251E-6Toma2013 E
NRG1     1-0125-003chr8:
31715386-31715386
CTintronicDe novo--Yuen2017 G
NRG1     1-0862-003chr8:
32799084-32799099
TTGATGTCAGGTAGTATintergenicDe novo--Yuen2017 G
NRG1     5-0095-003chr8:
32703799-32703799
GAintergenicDe novo--Yuen2017 G
NRG1     2-1398-003chr8:
32707560-32707560
GAintergenicDe novo--Yuen2017 G
NRG1     AU4149301chr8:
32229530-32229530
GAintronicDe novo--Yuen2017 G
NRG1     AU005213chr8:
32611272-32611272
AGintronicDe novo--Yuen2017 G
NRG1     AU072904chr8:
31690509-31690509
CTintronicDe novo--Yuen2017 G
NRG1     AU4093301chr8:
32620151-32620151
CAintronicDe novo--Yuen2017 G
NRG1     2-0289-004chr8:
32026915-32026915
CTintronicDe novo--Yuen2017 G
NRG1     AU4183301chr8:
31743575-31743575
AGintronicDe novo--Yuen2017 G
NRG1     AU4284301chr8:
31536504-31536504
GAintronicDe novo--Yuen2017 G
NRG1     1-0142-005chr8:
33027376-33027376
GAintergenicDe novo--Yuen2017 G
NRG1     AU4032306chr8:
31607777-31607777
TCintronicDe novo--Yuen2017 G
NRG1     2-1246-003chr8:
32572391-32572391
AGintronicDe novo--Yuen2017 G
NRG1     1-0112-003chr8:
31501379-31501379
GAintronicDe novo--Yuen2017 G
NRG1     AU3900302chr8:
32622433-32622433
GAUTR3De novo--Yuen2017 G
NRG1     1-0161-004chr8:
32887682-32887682
GAintergenicDe novo--Yuen2017 G
NRG1     AU3779304chr8:
32027943-32027943
GAintronicDe novo--Yuen2017 G
NRG1     2-0318-003chr8:
33210797-33210797
GAintergenicDe novo--Yuen2017 G
NRG1     1-0025-004chr8:
32924460-32924460
CTintergenicDe novo--Yuen2017 G
NRG1     1-0541-004chr8:
32825768-32825768
CTintergenicDe novo--Yuen2017 G
NRG1     AU039304chr8:
32337090-32337090
GCintronicDe novo--Yuen2017 G
NRG1     1-0225-003chr8:
31778203-31778203
TAintronicDe novo--Yuen2017 G
NRG1     AU3913302chr8:
32392284-32392284
GAintronicDe novo--Yuen2017 G
NRG1     1-0559-005chr8:
32291289-32291289
GAintronicDe novo--Yuen2017 G
NRG1     AU1725302chr8:
32465601-32465639
GTTTTTTTTGTTTTTTTTTTTTTTGTTTTTTTTTTTTTTGTTTTTTTTGTTTTTTTTTTTTTTintronicDe novo--Yuen2017 G
NRG1     2-0323-003chr8:
32221132-32221132
CTintronicDe novo--Yuen2017 G
NRG1     2-1592-003chr8:
32062766-32062766
AGintronicDe novo--Yuen2017 G
NRG1     AU4029301chr8:
31876536-31876536
AGintronicDe novo--Yuen2017 G
NRG1     2-1085-003chr8:
32124033-32124033
ACintronicDe novo--Yuen2017 G
NRG1     2-1715-003chr8:
32154722-32154722
CCTAGintronicDe novo--Yuen2017 G
NRG1     1-0534-003chr8:
31626014-31626014
TCintronicDe novo--Yuen2017 G
NRG1     2-0149-003chr8:
32171942-32171942
GAintronicDe novo--Yuen2017 G
NRG1     2-1290-004chr8:
32834741-32834741
TAintergenicDe novo--Yuen2017 G
NRG1     2-1178-003chr8:
32779781-32779781
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
NRG1     2-1120-003chr8:
31782635-31782635
TTAAintronicDe novo--Yuen2017 G
NRG1     7-0127-003chr8:
33038849-33038849
TCintergenicDe novo--Yuen2017 G
NRG1     1-0065-004chr8:
31771725-31771725
TGintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More