or
or
Exact

Results for "GPD2"

Variant Events: 48

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
GPD2     7-0023-003chr2:
157610311-157610311
AGintergenicDe novo--Yuen2017 G
GPD2     1-0045-003chr2:
157373815-157373815
GGACATintronicDe novo--Yuen2017 G
GPD2     AU2951302chr2:
157611315-157611315
AGintergenicDe novo--Yuen2017 G
GPD2     1-0282-003chr2:
157303568-157303568
CTintronicDe novo--Yuen2017 G
GPD2     2-1134-003chr2:
157390719-157390719
ACintronicDe novo--Yuen2017 G
GPD2     AU060004chr2:
157627222-157627223
ACAintergenicDe novo--Yuen2017 G
GPD2     2-1507-003chr2:
157685133-157685133
AGintergenicDe novo--Yuen2017 G
GPD2     2-1561-003chr2:
157357415-157357415
AGintronicDe novo--Yuen2017 G
GPD2     AU2951303chr2:
157611315-157611315
AGintergenicDe novo--Yuen2017 G
GPD2     1-0305-004chr2:
157673137-157673137
AGintergenicDe novo--Yuen2017 G
GPD2     1-0382-004chr2:
157432012-157432012
TCintronicDe novo--Yuen2017 G
GPD2     AU1355301chr2:
157435878-157435878
GAintronicDe novo--Yuen2017 G
GPD2     2-1506-003chr2:
157938439-157938441
TACTintergenicDe novo--Yuen2017 G
GPD2     09C98481chr2:
157406078-157406078
GCintronicDe novo-2.0E-4Satterstrom2020 E
GPD2     SJD_10chr2:
157427677-157427677
CTexonicMaternalnonsynonymous SNVNM_000408
NM_001083112
c.C1640T
c.C1640T
p.T547I
p.T547I
18.25-Toma2013 E
GPD2     2-1114-003chr2:
157807923-157807923
TGintergenicDe novo--Yuen2017 G
GPD2     AU3703302chr2:
158112322-158112322
AGintergenicDe novo--Yuen2017 G
GPD2     AU1988301chr2:
157422536-157422537
CTCTTintronicDe novo--Yuen2017 G
GPD2     AU4191302chr2:
157728794-157728794
TGintergenicDe novo--Yuen2017 G
GPD2     AU3874302chr2:
158037464-158037464
AGintergenicDe novo--Yuen2017 G
GPD2     A31chr2:
157693536-157693536
CAintergenicDe novo--Wu2018 G
GPD2     1-0045-004chr2:
157373815-157373815
GGACATintronicDe novo--Yuen2017 G
GPD2     2-1239-003chr2:
157690862-157690876
GCACACACACACACAGCACACACACACAintergenicDe novo--Yuen2017 G
GPD2     7-0255-003chr2:
157957953-157957953
ATintergenicDe novo--Yuen2017 G
GPD2     2-1508-003chr2:
157491993-157491993
AGintergenicDe novo--Yuen2017 G
GPD2     5-0095-003chr2:
157825441-157825441
TCintergenicDe novo--Yuen2017 G
GPD2     AU3398301chr2:
157857069-157857069
AGintergenicDe novo--Yuen2017 G
GPD2     1-0330-003chr2:
157847359-157847359
GGAAATintergenicDe novo--Yuen2017 G
GPD2     AU015903chr2:
157841627-157841627
CTintergenicDe novo--Yuen2017 G
GPD2     1-0567-004chr2:
157904363-157904363
CGintergenicDe novo--Yuen2017 G
GPD2     AU027506chr2:
158074709-158074709
AGintergenicDe novo--Yuen2017 G
GPD2     AU3794301chr2:
157844054-157844059
ACTTTCACintergenicDe novo--Yuen2017 G
GPD2     2-1170-003chr2:
158089316-158089321
TTTTTATintergenicDe novo--Yuen2017 G
GPD2     2-1461-003chr2:
157888773-157888773
ATintergenicDe novo--Yuen2016 G
Yuen2017 G
GPD2     A9chr2:
158049788-158049788
CTintergenicDe novo--Wu2018 G
GPD2     1-0965-003chr2:
157369259-157369259
GAintronicDe novo--Yuen2017 G
GPD2     AU4433301chr2:
157575484-157575484
TCintergenicDe novo--Yuen2017 G
GPD2     13023.p1chr2:
157762912-157762912
AGintergenicDe novo--Turner2016 G
GPD2     AU062204chr2:
157598530-157598530
CTintergenicDe novo--Yuen2017 G
GPD2     AU072004chr2:
157793199-157793199
AGintergenicDe novo--Yuen2017 G
GPD2     13069.p1chr2:
157789295-157789295
ATintergenicDe novo--Turner2016 G
GPD2     2-1277-003chr2:
157492051-157492051
CGintergenicDe novo--Yuen2017 G
GPD2     2-1381-003chr2:
157490557-157490557
ACintergenicDe novo--Yuen2017 G
GPD2     1-0010-003chr2:
157491993-157491993
AGintergenicDe novo--Yuen2017 G
GPD2     11002.p1chr2:
157949015-157949015
TAintergenicDe novo--Turner2016 G
GPD2     2-1425-004chr2:
158027291-158027291
GCintergenicDe novo--Yuen2017 G
GPD2     AU3124302chr2:
157489068-157489068
TAintergenicDe novo--Yuen2017 G
GPD2     7-0254-004chr2:
157549843-157549843
TAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More