or
or
Exact

Results for "CABIN1"

Variant Events: 18

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CABIN1     iHART2614chr22:
24459610-24459610
GAsplicingMaternalsplicing23.08.238E-6Ruzzo2019 G
CABIN1     DEASD_0426_001chr22:
24452747-24452747
CTexonicDe novononsynonymous SNVNM_001201429
NM_001199281
NM_012295
c.C1036T
c.C1186T
c.C1186T
p.R346C
p.R396C
p.R396C
25.7-DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
CABIN1     2-1239-003chr22:
24454018-24454018
CTintronicDe novo--Yuen2016 G
Yuen2017 G
CABIN1     iHART2613chr22:
24459610-24459610
GAsplicingMaternalsplicing23.08.238E-6Ruzzo2019 G
CABIN1     iHART1374chr22:
24445592-24445593
GCGexonicPaternalframeshift deletionNM_001199281
NM_001201429
NM_012295
c.567delC
c.567delC
c.567delC
p.C189fs
p.C189fs
p.C189fs
-8.241E-6Ruzzo2019 G
CABIN1     2-0225-004chr22:
24502392-24502392
GGCTCTGGGTTAintronicDe novo--Yuen2017 G
CABIN1     MT_109chr22:
24456455-24456455
CTexonicPaternalnonsynonymous SNVNM_001201429
NM_001199281
NM_012295
c.C1318T
c.C1468T
c.C1468T
p.R440C
p.R490C
p.R490C
20.95.0E-4Toma2013 E
CABIN1     102-10-113091chr22:
24439358-24439358
GTintronicDe novo-8.318E-6Satterstrom2020 E
CABIN1     G01-GEA-92-HIchr22:
24480767-24480767
GAintronicDe novo--Satterstrom2020 E
CABIN1     2-0045-003chr22:
24459686-24459721
GGTGTGTGTGTGTATGTGTGTGTGTGTGTGTGTGTGGGTGTGTGTGTATGTGTGTGTGTGTGTGTGTGTGintronicDe novo--Yuen2017 G
CABIN1     2-0116-004chr22:
24556500-24556500
AGintronicDe novo--Yuen2017 G
CABIN1     111300chr22:
24462966-24462966
GAexonicnonsynonymous SNVNM_001201429
NM_001199281
NM_012295
c.G1916A
c.G2066A
c.G2066A
p.R639Q
p.R689Q
p.R689Q
36.01.648E-5Woodbury-Smith2022 E
CABIN1     AU4433301chr22:
24532253-24532253
GCintronicDe novo--Yuen2017 G
CABIN1     1-0158-012chr22:
24531567-24531567
CCCTCTAintronicDe novo--Yuen2017 G
CABIN1     13757.p1chr22:
24456554-24456554
ACexonicDe novononsynonymous SNVNM_001201429
NM_001199281
NM_012295
c.A1417C
c.A1567C
c.A1567C
p.T473P
p.T523P
p.T523P
13.19-Satterstrom2020 E
CABIN1     1-0772-003chr22:
24479388-24479388
TCintronicDe novo--Yuen2017 G
CABIN1     NDAR_INVCU674HCJ_wes1chr22:
24460666-24460666
CTintronicDe novo-1.651E-5Kosmicki2017 E
Satterstrom2020 E
CABIN1     5-0030-003chr22:
24564450-24564450
GTexonicDe novononsynonymous SNVNM_001201429
NM_001199281
NM_012295
c.G5568T
c.G5718T
c.G5718T
p.K1856N
p.K1906N
p.K1906N
18.65-Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More