or
or
Exact

Results for "BTNL9"

Variant Events: 11

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
BTNL9     AU3649305chr5:
180470183-180470197
CGTGTGTGTGTGTGTCGTGTGTGTGTGTintronicDe novo--Yuen2017 G
BTNL9     AU3371301chr5:
180476937-180476937
TCintronicDe novo--Yuen2017 G
BTNL9     AU4056301chr5:
180477361-180477361
AGexonicDe novononsynonymous SNVNM_001308245
NM_152547
c.A728G
c.A728G
p.Q243R
p.Q243R
13.26-Yuen2017 G
BTNL9     iHART2321chr5:
180472466-180472466
GCsplicingPaternalsplicing--Ruzzo2019 G
BTNL9     MT_109chr5:
180477253-180477255
ACCACexonicMaternalframeshift deletionNM_001308245
NM_152547
c.622delC
c.622delC
p.L208fs
p.L208fs
--Toma2013 E
BTNL9     iHART2319chr5:
180472466-180472466
GCsplicingPaternalsplicing--Ruzzo2019 G
BTNL9     iHART2320chr5:
180472466-180472466
GCsplicingPaternalsplicing--Ruzzo2019 G
BTNL9     5-0014-004chr5:
180534811-180534811
GAintergenicDe novo--Yuen2017 G
BTNL9     SSC09520chr5:
180474955-180474955
CTexonicDe novosynonymous SNVNM_001308245
NM_152547
c.C138T
c.C138T
p.P46P
p.P46P
--Lim2017 E
BTNL9     AU3861303chr5:
180549379-180549379
TCintergenicDe novo--Yuen2017 G
BTNL9     14070.p1chr5:
180474955-180474955
CTexonicDe novosynonymous SNVNM_001308245
NM_152547
c.C138T
c.C138T
p.P46P
p.P46P
--Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More