or
or
Exact

Results for "ADCY8"

Variant Events: 73

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ADCY8     AU4211304chr8:
132297082-132297082
CTintergenicDe novo--Yuen2017 G
ADCY8     AU055004chr8:
132758232-132758232
CGintergenicDe novo--Yuen2017 G
ADCY8     2-0028-003chr8:
131951816-131951816
GAintronicDe novo--Yuen2016 G
Yuen2017 G
ADCY8     AU3764302chr8:
132614608-132614608
GAintergenicDe novo--Yuen2017 G
ADCY8     1-0158-003chr8:
132015977-132015977
CGintronicDe novo--Yuen2017 G
ADCY8     1-0286-004chr8:
132357622-132357622
CTintergenicDe novo--Yuen2017 G
ADCY8     1-0353-003chr8:
132190754-132190754
TCintergenicDe novo--Yuen2017 G
ADCY8     AU3997302chr8:
132205357-132205357
TAintergenicDe novo--Yuen2017 G
ADCY8     AU1995302chr8:
132083095-132083097
CATCintergenicDe novo--Yuen2017 G
ADCY8     3-0458-000Bchr8:
132645857-132645857
CTintergenicDe novo--Yuen2017 G
ADCY8     AU2035302chr8:
132787594-132787594
ATintergenicDe novo--Yuen2017 G
ADCY8     1-0513-003chr8:
132150469-132150469
CGintergenicDe novo--Yuen2016 G
Yuen2017 G
ADCY8     1-0591-003chr8:
132446783-132446783
GAintergenicDe novo--Yuen2017 G
ADCY8     AU3997302chr8:
132205360-132205360
TAintergenicDe novo--Yuen2017 G
ADCY8     AU3997302chr8:
132206489-132206489
CAintergenicDe novo--Yuen2017 G
ADCY8     AU4015302chr8:
132688815-132688815
CAintergenicDe novo--Yuen2017 G
ADCY8     SJD_10chr8:
131921998-131921998
CTexonicPaternalstopgainNM_001115c.G1596Ap.W532X54.0-Toma2013 E
ADCY8     AU024105chr8:
131961241-131961241
GTintronicDe novo--Yuen2017 G
ADCY8     2-1251-003chr8:
132578949-132578949
AGintergenicDe novo--Yuen2017 G
ADCY8     5-0014-004chr8:
132762137-132762137
GAintergenicDe novo--Yuen2017 G
ADCY8     1-0049-004chr8:
132476161-132476161
CTintergenicDe novo--Yuen2017 G
ADCY8     AU056005chr8:
132007909-132007909
CGintronicDe novo--Yuen2017 G
ADCY8     AU3695303chr8:
132784663-132784663
GTintergenicDe novo--Yuen2017 G
ADCY8     2-1737-003chr8:
132501600-132501600
TCintergenicDe novo--Yuen2017 G
ADCY8     1-0138-004chr8:
132353794-132353794
TCintergenicDe novo--Yuen2017 G
ADCY8     1-0265-004chr8:
132339018-132339018
CCAAAACAAAAACAAGAACACAGAAAATintergenicDe novo--Yuen2017 G
ADCY8     2-1290-003chr8:
131816911-131816911
AGintronicDe novo--Yuen2017 G
ADCY8     5-0106-003chr8:
132072420-132072420
GAintergenicDe novo--Yuen2017 G
ADCY8     AU072004chr8:
132516751-132516751
ACintergenicDe novo--Yuen2017 G
ADCY8     AU2035301chr8:
132787594-132787594
ATintergenicDe novo--Yuen2017 G
ADCY8     7-0192-003chr8:
132850900-132850900
ACintergenicDe novo--Yuen2017 G
ADCY8     14069.p1chr8:
131949457-131949457
CAintronicDe novo--Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
ADCY8     AU3702306chr8:
132817019-132817019
GCintergenicDe novo--Yuen2017 G
ADCY8     AU3905301chr8:
132487286-132487286
CTintergenicDe novo--Yuen2017 G
ADCY8     2-1327-004chr8:
132867885-132867885
AGintergenicDe novo--Yuen2017 G
ADCY8     3-0458-000Achr8:
132645857-132645857
CTintergenicDe novo--Yuen2017 G
ADCY8     1-0271-004chr8:
132806318-132806318
GAintergenicDe novo--Yuen2017 G
ADCY8     1-0271-004chr8:
132353794-132353794
TCintergenicDe novo--Yuen2017 G
ADCY8     AU1404302chr8:
132076178-132076178
CAintergenicDe novo--Yuen2017 G
ADCY8     2-0132-004chr8:
132353794-132353794
TCintergenicDe novo--Yuen2017 G
ADCY8     2-1594-003chr8:
132073416-132073416
TCintergenicDe novo--Yuen2017 G
ADCY8     2-0285-003chr8:
132480066-132480066
TCintergenicDe novo--Yuen2017 G
ADCY8     AU3808304chr8:
132229672-132229672
TCintergenicDe novo--Yuen2017 G
ADCY8     AU2863302chr8:
132425233-132425233
GAintergenicDe novo--Yuen2017 G
ADCY8     2-1094-005chr8:
132353794-132353794
TCintergenicDe novo--Yuen2017 G
ADCY8     1-0507-003chr8:
132119474-132119474
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
ADCY8     AU3912303chr8:
132797183-132797183
ACintergenicDe novo--Yuen2017 G
ADCY8     AU4468301chr8:
131840235-131840235
CAintronicDe novo--Yuen2017 G
ADCY8     1-0073-003chr8:
132754719-132754719
GTintergenicDe novo--Yuen2017 G
ADCY8     5-0105-003chr8:
132768409-132768411
TAATAAAintergenicDe novo--Yuen2017 G
ADCY8     1-0073-003chr8:
132751838-132751838
CTintergenicDe novo--Yuen2017 G
ADCY8     AU079104chr8:
131815609-131815609
CAintronicDe novo--Yuen2017 G
ADCY8     1-0674-004chr8:
132892215-132892215
GAintergenicDe novo--Yuen2017 G
ADCY8     1-0494-003chr8:
132353828-132353828
AGintergenicDe novo--Yuen2017 G
ADCY8     7-0251-003chr8:
132732317-132732317
GAintergenicDe novo--Yuen2017 G
ADCY8     1-0973-003chr8:
132741387-132741387
GAintergenicDe novo--Yuen2017 G
ADCY8     1-0171-005chr8:
132119711-132119711
AGintergenicDe novo--Yuen2017 G
ADCY8     2-0238-004chr8:
131821631-131821631
TCintronicDe novo--Yuen2017 G
ADCY8     AU4479301chr8:
132577291-132577293
TAATAintergenicDe novo--Yuen2017 G
ADCY8     2-0109-003chr8:
132571746-132571746
AGintergenicDe novo--Yuen2017 G
ADCY8     AU3716302chr8:
132624013-132624013
GCintergenicDe novo--Yuen2017 G
ADCY8     1-0191-004chr8:
132353794-132353794
TCintergenicDe novo--Yuen2017 G
ADCY8     2-0129-005chr8:
132448634-132448634
TGintergenicDe novo--Yuen2017 G
ADCY8     1-0329-004chr8:
132587310-132587310
CTintergenicDe novo--Yuen2017 G
ADCY8     AU3716302chr8:
132479584-132479584
TCintergenicDe novo--Yuen2017 G
ADCY8     1-0972-003chr8:
132706141-132706141
AGintergenicDe novo--Yuen2017 G
ADCY8     2-1444-003chr8:
131819789-131819789
CAintronicDe novo--Yuen2017 G
ADCY8     2-1313-003chr8:
132792721-132792721
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
ADCY8     AU2951303chr8:
132573321-132573321
ACintergenicDe novo--Yuen2017 G
ADCY8     1-0244-003chr8:
132735308-132735308
TAintergenicDe novo--Yuen2016 G
Yuen2017 G
ADCY8     AU2140305chr8:
132154890-132154890
AGintergenicDe novo--Yuen2017 G
ADCY8     AU2951302chr8:
132573321-132573321
ACintergenicDe novo--Yuen2017 G
ADCY8     AU4007301chr8:
132722226-132722226
GCintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More