
Results for "GALNT9"

Variant Events: 17

Gene symbol on which the variant is located
Subject Identifier from the original study
Genomic location of the reference allele
Reference allele
Alternate allele
Variant functional categories
Variant validation performed by an orthogonal method and reported
Reported inheritance status
Variant effect on transcript per Annovar
Transcript used for the cDNA/Protein mutation
cDNA variant notation
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Source(s) where variants from this event are reported
GALNT9     1-0541-004chr12:
GAintronicDe novo--Yuen2017 G
GALNT9     1-0482-003chr12:
GCintronicDe novo--Yuen2016 G
GALNT9     A2chr12:
GAintronicDe novo--Wu2018 G
GALNT9     2-1441-003chr12:
GALNT9     AU2075301chr12:
GAintronicDe novo--Yuen2017 G
GALNT9     AU3888302chr12:
GAintronicDe novo-0.02Yuen2017 G
GALNT9     1-0556-003chr12:
CAintronicDe novo--Yuen2017 G
GALNT9     AU4239301chr12:
CTintronicDe novo--Yuen2017 G
GALNT9     EGAN00001101176chr12:
ACexonicDe novosynonymous SNVNM_001122636c.T291Gp.G97G-5.0E-4Satterstrom2020 E
GALNT9     SSC06156chr12:
GAexonicDe novononsynonymous SNVNM_021808
17.941.664E-5Fu2022 E
GALNT9     12626.p1chr12:
GAexonicDe novononsynonymous SNVNM_021808
17.941.664E-5Iossifov2012 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
GALNT9     SP0090070chr12:
GAexonicDe novononsynonymous SNVNM_001122636c.C488Tp.A163V25.45.105E-5Fu2022 E
GALNT9     2-1696-003chr12:
CTintronicDe novo--Yuen2017 G
GALNT9     AU076509chr12:
GCintronicDe novo--Yuen2017 G
GALNT9     NDAR_INVWL738LDP_wes1chr12:
CAexonicDe novononsynonymous SNVNM_021808
23.7-Lim2017 E
GALNT9     1-0231-004chr12:
CCATintronicDe novo--Yuen2017 G
GALNT9     AU2950301chr12:
GACACACACACGACACACACintronicDe novo--Yuen2017 G
Source Variant Information

, -


Paper alias:

No records found.
Paper Information
Variant source
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView