or
or
Exact

Results for "PLIN4"

Variant Events: 13

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PLIN4     AU098Achr19:
4511513-4511513
GAexonicDe novononsynonymous SNVNM_001080400c.C2417Tp.T806M12.143.437E-5Satterstrom2020 E
PLIN4     iHART1448chr19:
4512816-4512816
GAexonicPaternalstopgainNM_001080400c.C1114Tp.Q372X21.46.0E-4Ruzzo2019 G
PLIN4     iHART2136chr19:
4511414-4511415
GTGexonicMaternalframeshift deletionNM_001080400c.2515delAp.T839fs-8.423E-6Ruzzo2019 G
PLIN4     iHART1891chr19:
4510908-4510908
CTexonicDe novononsynonymous SNVNM_001080400c.G3022Ap.V1008M11.67-Ruzzo2019 G
PLIN4     iHART2458chr19:
4504914-4504914
GAexonicPaternalstopgainNM_001080400c.C3706Tp.Q1236X38.07.61E-5Ruzzo2019 G
PLIN4     Shi2013:2chr19:
4504602-4504602
GAexonicInheritednonsynonymous SNVNM_001080400c.C3943Tp.R1315W10.425.0E-4Shi2013 G
PLIN4     CC1131.202chr19:
4512657-4512657
CCAexonicDe novoframeshift insertionNM_001080400c.1272dupTp.G425fs--Satterstrom2020 E
PLIN4     Shi2013:1chr19:
4504602-4504602
GAexonicInheritednonsynonymous SNVNM_001080400c.C3943Tp.R1315W10.425.0E-4Shi2013 G
PLIN4     1-0579-003chr19:
4504009-4504009
CTUTR3De novo--Yuen2017 G
PLIN4     13898.p1chr19:
4511908-4511908
CCTACACCCGTCTGGACGGCCCCCTTGGCCACGTTCGCAGCACCGGTGACCCCACTGCAGACGGTGTCCTTGGTGCCGGTCAGCACGGTCTTGGCTexonicDe novoframeshift insertionNM_001080400c.2021_2022insAGCCAAGACCGTGCTGACCGGCACCAAGGACACCGTCTGCAGTGGGGTCACCGGTGCTGCGAACGTGGCCAAGGGGGCCGTCCAGACGGGTGTAp.T674fs--Satterstrom2020 E
PLIN4     09C80113chr19:
4510966-4510966
GAexonicDe novosynonymous SNVNM_001080400c.C2964Tp.T988T-0.0033DeRubeis2014 E
Kosmicki2017 E
PLIN4     DEASD_0197_001chr19:
4512088-4512088
GAexonicDe novosynonymous SNVNM_001080400c.C1842Tp.T614T-8.283E-5DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
PLIN4     13706.p1chr19:
4512926-4512926
TCexonicDe novononsynonymous SNVNM_001080400c.A1004Gp.K335R17.617.165E-5Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More