or
or
Exact

Results for "MUC4"

Variant Events: 41

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
MUC4     Shi2013:2chr3:
195510850-195510850
GTexonicInheritednonsynonymous SNVNM_018406c.C7601Ap.A2534D9.8835.0E-4Shi2013 G
MUC4     13293.p1chr3:
195509428-195509428
GAexonicDe novononsynonymous SNVNM_018406c.C9023Tp.S3008F7.6874.0E-4Iossifov2012 E
Iossifov2014 E
Kosmicki2017 E
MUC4     Li2017:23673chr3:
195488430-195488430
CTexonicUnknownnonsynonymous SNVNM_138297
NM_004532
NM_018406
c.G1678A
c.G1831A
c.G14539A
p.D560N
p.D611N
p.D4847N
17.43-Li2017 T
MUC4     A24chr3:
195510226-195510226
GGGexonicDe novoframeshift insertionNM_018406c.8225dupCp.T2742fs--Wu2018 G
MUC4     Shi2013:1chr3:
195510850-195510850
GTexonicInheritednonsynonymous SNVNM_018406c.C7601Ap.A2534D9.8835.0E-4Shi2013 G
MUC4     A4chr3:
195513384-195513385
AGAexonicDe novoframeshift deletionNM_018406c.5066delCp.A1689fs--Wu2018 G
MUC4     80001104634chr3:
195506953-195506953
GAexonicDe novononsynonymous SNVNM_018406c.C11498Tp.A3833V6.5035.0E-4Satterstrom2020 E
MUC4     09C86928chr3:
195511272-195511279
TGCTGAGGTexonicDe novoframeshift deletionNM_018406c.7172_7178delp.S2391fs-1.0E-4Satterstrom2020 E
MUC4     13635.p1chr3:
195507684-195507684
GAexonicDe novosynonymous SNVNM_018406c.C10767Tp.D3589D-6.184E-5Iossifov2014 E
Kosmicki2017 E
MUC4     12573.p1chr3:
195511918-195511918
GTexonicDe novononsynonymous SNVNM_018406c.C6533Ap.P2178H6.5410.0195Iossifov2014 E
Kosmicki2017 E
MUC4     Li2017:39chr3:
195513289-195513289
AAGexonicUnknownframeshift insertionNM_018406c.5161_5162insCp.V1721fs--Li2017 T
MUC4     14240.p1chr3:
195509942-195509942
TTGGTGACAGGAAGCGAGGTGGCGTGACCTGTGAACACTGAGGAAGCGTCexonicDe novononframeshift insertionNM_018406c.8508_8509insGACGCTTCCTCAGTGTTCACAGGTCACGCCACCTCGCTTCCTGTCACCp.I2837delinsDASSVFTGHATSLPVTI--Satterstrom2020 E
MUC4     13741.p1chr3:
195512768-195512768
TAexonicDe novononsynonymous SNVNM_018406c.A5683Tp.N1895Y6.1160.084Iossifov2014 E
Kosmicki2017 E
MUC4     13010.p1chr3:
195509304-195509350
TGCTGAGGAAGTGTCGGTGACAGGAAGCGGGGTGGCGTGACCGGTGGTexonicDe novoframeshift deletionNM_018406c.9101_9146delp.S3034fs--Satterstrom2020 E
MUC4     12829.p1chr3:
195506022-195506022
CCGTGGTGTCACCTGTTGATACTGAGGAAAGGCTGGTGACAGGAAGAGGGGTGGCCTGACCTGTGGATGCCGAGGAAGCGTCGGTGACAGGAAGAGGGGTGGTGTCACCTGTGGATGCTGAGGAAGTGTCGGTGACAGGAAGAGGGGTGGCGTGACCGGTGGATGCCGAGGAAGCGTCGGTGACAGGAAGAGGGexonicDe novononframeshift insertionNM_018406c.12428_12429insCCCTCTTCCTGTCACCGACGCTTCCTCGGCATCCACCGGTCACGCCACCCCTCTTCCTGTCACCGACACTTCCTCAGCATCCACAGGTGACACCACCCCTCTTCCTGTCACCGACGCTTCCTCGGCATCCACAGGTCAGGCCACCCCTCTTCCTGTCACCAGCCTTTCCTCAGTATCAACAGGTGACACCACp.T4143delinsTPLPVTDASSASTGHATPLPVTDTSSASTGDTTPLPVTDASSASTGQATPLPVTSLSSVSTGDTT--Satterstrom2020 E
MUC4     13598.p1chr3:
195515198-195515198
CGexonicDe novononsynonymous SNVNM_018406c.G3253Cp.D1085H2.218-Iossifov2014 E
Kosmicki2017 E
MUC4     14482.p1chr3:
195521459-195521459
CGintronicDe novo--Turner2016 G
MUC4     14023.p1chr3:
195509246-195509246
GTexonicDe novononsynonymous SNVNM_018406c.C9205Ap.H3069N0.006-Lim2017 E
MUC4     F10405-1chr3:
195517413-195517413
CTexonicDe novosynonymous SNVNM_018406c.G1038Ap.P346P-1.656E-5Satterstrom2020 E
MUC4     SSC08609chr3:
195507684-195507684
GAexonicDe novosynonymous SNVNM_018406c.C10767Tp.D3589D-6.184E-5Lim2017 E
MUC4     CC955.201chr3:
195511844-195511844
TGexonicMosaicnonsynonymous SNVNM_018406c.A6607Cp.T2203P4.4173.0E-4Lim2017 E
MUC4     SP0015103chr3:
195486122-195486122
CTexonicDe novosynonymous SNVNM_138297
NM_004532
NM_018406
c.G1998A
c.G2151A
c.G14859A
p.P666P
p.P717P
p.P4953P
-8.249E-5Feliciano2019 E
MUC4     161008chr3:
195508955-195508957
CCTCexonicDe novoframeshift deletionNM_018406c.9494_9495delp.Q3165fs-2.0E-4Satterstrom2020 E
MUC4     08C74343chr3:
195506312-195506399
TGGTGTCACCTGTGGATGCTGAGGAAGTGCTGGTGACAGGAACAGGGGTGGCGTGACCTGTGGATGCTGAGGAAGGGCTGGTGACAGGTexonicDe novononframeshift deletionNM_018406c.12052_12138delp.4018_4046del-7.906E-5Satterstrom2020 E
MUC4     13850.p1chr3:
195509511-195509511
GAexonicMosaicsynonymous SNVNM_018406c.C8940Tp.T2980T--Lim2017 E
MUC4     NDAR_INVNK094EPH_wes1chr3:
195515997-195515997
GTexonicDe novononsynonymous SNVNM_018406c.C2454Ap.S818R5.7428.295E-6DeRubeis2014 E
Kosmicki2017 E
Satterstrom2020 E
MUC4     Li2017:15021chr3:
195513382-195513382
GGAexonicUnknownframeshift insertionNM_018406c.5068_5069insTp.T1690fs--Li2017 T
MUC4     14208.p1chr3:
195553205-195553206
ACAintergenicDe novo--Wilfert2021 G
MUC4     14091.p1chr3:
195479489-195479490
AGGCintronicMaternal--Wilfert2021 G
MUC4     2-1207-003chr3:
195512590-195512590
GTexonicDe novononsynonymous SNVNM_018406c.C5861Ap.P1954H2.532-Yuen2017 G
MUC4     SSC12823chr3:
195512542-195512542
GAexonicMosaicnonsynonymous SNVNM_018406c.C5909Tp.P1970L5.066-Lim2017 E
MUC4     SSC10347chr3:
195512399-195512399
GTexonicMosaicnonsynonymous SNVNM_018406c.C6052Ap.P2018T5.261-Lim2017 E
MUC4     13196.p1chr3:
195510958-195510958
GCexonicDe novononsynonymous SNVNM_018406c.C7493Gp.P2498R8.811-Krumm2015 E
MUC4     13786.p1chr3:
195509626-195509626
GCexonicDe novononsynonymous SNVNM_018406c.C8825Gp.T2942S5.019-Krumm2015 E
MUC4     2-1207-003chr3:
195512612-195512612
ATexonicDe novononsynonymous SNVNM_018406c.T5839Ap.S1947T1.5928.033E-5Yuen2017 G
MUC4     20-0500310-23chr3:
195510772-195510772
GGGGGTGGTGTCexonicDe novostopgainNM_018406c.7678_7679insGACACCACCCp.S2560_L2561delinsX--Satterstrom2020 E
MUC4     2-1741-003chr3:
195532287-195532287
GAintronicDe novo--Yuen2017 G
MUC4     08C77861chr3:
195505250-195505250
GAexonicDe novosynonymous SNVNM_004532
NM_018406
c.C159T
c.C12867T
p.T53T
p.T4289T
--Neale2012 E
MUC4     iHART1291chr3:
195501120-195501121
TCTexonicPaternalframeshift deletionNM_138297
NM_004532
NM_018406
c.138delG
c.291delG
c.12999delG
p.R46fs
p.R97fs
p.R4333fs
-1.0E-4Ruzzo2019 G
MUC4     1-0518-003chr3:
195488225-195488225
CTintronicDe novo--Yuen2016 G
Yuen2017 G
MUC4     2-1567-003chr3:
195570056-195570056
CCTTintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More