or
or
Exact

Results for "SPATA31D1"

Variant Events: 65

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SPATA31D1     11089.p1chr9:
84752436-84752436
TCintergenicDe novo--Turner2016 G
SPATA31D1     2-0289-003chr9:
84856428-84856428
GAintergenicDe novo--Yuen2017 G
SPATA31D1     12175.p1chr9:
84756123-84756123
GTintergenicDe novo--Turner2016 G
SPATA31D1     2-1300-003chr9:
84878418-84878432
GCACACACACACACAGCACACACACACAintergenicDe novo--Yuen2017 G
SPATA31D1     14637.p1chr9:
84756145-84756145
CTintergenicDe novo--Turner2016 G
SPATA31D1     14637.p1chr9:
84756147-84756147
CTintergenicDe novo--Turner2016 G
SPATA31D1     12175.p1chr9:
84756129-84756129
AGintergenicDe novo--Turner2016 G
SPATA31D1     1-0045-004chr9:
85372645-85372645
TCintergenicDe novo--Yuen2017 G
SPATA31D1     12175.p1chr9:
84756145-84756145
CTintergenicDe novo--Turner2016 G
SPATA31D1     AU4219302chr9:
85006652-85006652
GAintergenicDe novo--Yuen2017 G
SPATA31D1     14642.p1chr9:
85179847-85179847
AGintergenicDe novo--Turner2016 G
SPATA31D1     AU4235303chr9:
84737517-84737522
TGTAGTTGTintergenicDe novo--Yuen2017 G
SPATA31D1     AU4211304chr9:
85479281-85479281
CGintergenicDe novo--Yuen2017 G
SPATA31D1     2-1264-003chr9:
85140767-85140767
GTintergenicDe novo--Yuen2016 G
Yuen2017 G
SPATA31D1     7-0129-003chr9:
85387494-85387494
GAintergenicDe novo--Yuen2017 G
SPATA31D1     AU3997302chr9:
84747298-84747298
TAintergenicDe novo--Yuen2017 G
SPATA31D1     1-0978-003chr9:
85587357-85587357
TCintergenicDe novo--Yuen2017 G
SPATA31D1     1-0489-003chr9:
85423955-85423955
TCintergenicDe novo--Yuen2017 G
SPATA31D1     2-0102-004chr9:
85202188-85202192
GTTAAGintergenicDe novo--Yuen2017 G
SPATA31D1     2-0238-003chr9:
85440308-85440308
AGintergenicDe novo--Yuen2017 G
SPATA31D1     AU4336301chr9:
84954133-84954133
ACintergenicDe novo--Yuen2017 G
SPATA31D1     Shi2013:1chr9:
84607127-84607127
TAexonicInheritednonsynonymous SNVNM_001001670c.T1742Ap.L581Q0.013-Shi2013 G
SPATA31D1     74-0688chr9:
85574933-85574933
ACintergenicDe novo--Michaelson2012 G
SPATA31D1     1-0898-003chr9:
85099510-85099510
ATintergenicDe novo--Yuen2017 G
SPATA31D1     AU3713302chr9:
85359295-85359295
CTintergenicDe novo--Yuen2017 G
SPATA31D1     AU075703chr9:
84888814-84888814
AGintergenicDe novo--Yuen2017 G
SPATA31D1     AU072004chr9:
85460786-85460786
ATintergenicDe novo--Yuen2017 G
SPATA31D1     AU4392302chr9:
84705132-84705132
CAintergenicDe novo--Yuen2017 G
SPATA31D1     AU2019302chr9:
85075157-85075157
CAintergenicDe novo--Yuen2017 G
SPATA31D1     1-0045-003chr9:
85478592-85478592
GAintergenicDe novo--Yuen2017 G
SPATA31D1     AU3891302chr9:
85016210-85016210
TAintergenicDe novo--Yuen2017 G
SPATA31D1     1-0025-006chr9:
85525566-85525566
GAintergenicDe novo--Yuen2017 G
SPATA31D1     5-0125-003chr9:
84824296-84824296
TCintergenicDe novo--Yuen2017 G
SPATA31D1     11948.p1chr9:
85283827-85283827
CTintergenicDe novo--Wilfert2021 G
SPATA31D1     1-0571-003chr9:
84635823-84635823
AGintergenicDe novo--Yuen2017 G
SPATA31D1     5-0042-003chr9:
84845501-84845501
GAintergenicDe novo--Yuen2017 G
SPATA31D1     2-0318-004chr9:
84708606-84708606
ATintergenicDe novo--Yuen2017 G
SPATA31D1     14410.p1chr9:
85225031-85225031
GAintergenicDe novo--Werling2018 G
SPATA31D1     AU003405chr9:
85147340-85147340
TCintergenicDe novo--Yuen2017 G
SPATA31D1     AU2433302chr9:
84618620-84618620
TCintergenicDe novo--Yuen2017 G
SPATA31D1     2-0081-003chr9:
85211669-85211669
AGintergenicDe novo--Yuen2017 G
SPATA31D1     2-1085-004chr9:
85408571-85408571
GAintergenicDe novo--Yuen2017 G
SPATA31D1     2-0081-003chr9:
84880083-84880083
TCintergenicDe novo--Yuen2017 G
SPATA31D1     2-0081-003chr9:
85313435-85313435
TTAACintergenicDe novo--Yuen2017 G
SPATA31D1     Shi2013:2chr9:
84607127-84607127
TAexonicInheritednonsynonymous SNVNM_001001670c.T1742Ap.L581Q0.013-Shi2013 G
SPATA31D1     A32chr9:
84705788-84705788
GAintergenicDe novo--Wu2018 G
SPATA31D1     1-0547-003chr9:
84702528-84702528
AGintergenicDe novo--Yuen2017 G
SPATA31D1     AU4093304chr9:
85156799-85156799
ATintergenicDe novo--Yuen2017 G
SPATA31D1     AU1860302chr9:
85212729-85212729
GAintergenicDe novo--Yuen2017 G
SPATA31D1     2-1629-003chr9:
84645509-84645509
AGintergenicDe novo--Yuen2017 G
SPATA31D1     1-0253-005chr9:
85372652-85372652
GTintergenicDe novo--Yuen2017 G
SPATA31D1     AU4234303chr9:
85537597-85537597
CTintergenicDe novo--Yuen2017 G
SPATA31D1     2-1266-003chr9:
85119714-85119714
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
SPATA31D1     AU026412chr9:
85551660-85551660
CTintergenicDe novo--Yuen2017 G
SPATA31D1     2-0296-004chr9:
85065214-85065214
TAintergenicDe novo--Yuen2017 G
SPATA31D1     2-0323-003chr9:
84733651-84733651
CTintergenicDe novo--Yuen2017 G
SPATA31D1     1-0486-003chr9:
85271410-85271410
AGintergenicDe novo--Yuen2017 G
SPATA31D1     2-0214-003chr9:
85443967-85443967
TCintergenicDe novo--Yuen2017 G
SPATA31D1     1-0232-004chr9:
84878739-84878739
ACintergenicDe novo--Yuen2017 G
SPATA31D1     AU3900301chr9:
84980958-84980958
AGintergenicDe novo--Yuen2017 G
SPATA31D1     1-0985-003chr9:
84764830-84764830
GAintergenicDe novo--Yuen2017 G
SPATA31D1     2-1738-003chr9:
85147703-85147703
GAintergenicDe novo--Yuen2017 G
SPATA31D1     2-1350-003chr9:
84664072-84664074
CAGCintergenicDe novo--Yuen2017 G
SPATA31D1     2-1086-004chr9:
85068143-85068143
GGAAGCintergenicDe novo--Yuen2017 G
SPATA31D1     AU056204chr9:
85150687-85150687
ACintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More