or
or
Exact

Results for "BAHD1"

Variant Events: 6

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
BAHD1     1-0560-003chr15:
40748165-40748187
ATGTTGTTGTTGTTGTTGTTGTTATGTTGTTGTTGTTGTTGTTintronicDe novo--Yuen2017 G
BAHD1     A19chr15:
40757171-40757171
CTintronicDe novo--Wu2018 G
BAHD1     Shi2013:2chr15:
40751592-40751592
TAexonicInheritednonsynonymous SNVNM_001301132
NM_014952
c.T929A
c.T929A
p.L310Q
p.L310Q
16.244.218E-5Shi2013 G
BAHD1     SP0041645chr15:
40750758-40750758
ATexonicDe novononsynonymous SNVNM_001301132
NM_014952
c.A95T
c.A95T
p.Q32L
p.Q32L
13.78-Feliciano2019 E
BAHD1     09C81661chr15:
40758109-40758109
AGintronicDe novo-2.0E-4Satterstrom2020 E
BAHD1     Shi2013:1chr15:
40751592-40751592
TAexonicInheritednonsynonymous SNVNM_001301132
NM_014952
c.T929A
c.T929A
p.L310Q
p.L310Q
16.244.218E-5Shi2013 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More