or
or
Exact

Results for "Costa2023"

Variant Events: 37

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PBRM1     Costa2023:P2-1chr3:
52597431-52597431
CAexonicDe novononsynonymous SNVNM_018313c.G3879Tp.E1293D5.467-Costa2023 E
SART3     Costa2023:P1-1chr12:
108939019-108939019
CTexonicDe novononsynonymous SNVNM_014706c.G625Ap.V209M24.91.647E-5Costa2023 E
ITIH2     Costa2023:P3-1chr10:
7763722-7763722
GTexonicDe novononsynonymous SNVNM_002216c.G849Tp.E283D7.425-Costa2023 E
WDFY3     Costa2023:P3-1chr4:
85636495-85636495
GTexonicDe novostopgainNM_014991c.C7917Ap.Y2639X24.7-Costa2023 E
HDAC9     Costa2023:P1-1chr7:
18833005-18833005
CGexonicDe novononsynonymous SNVNM_058176
NM_178425
NM_178423
c.C2243G
c.C2252G
c.C2243G
p.S748C
p.S751C
p.S748C
16.15-Costa2023 E
MTR     Costa2023:P1-1chr1:
237025561-237025561
AGexonicDe novononsynonymous SNVNM_001291939
NM_001291940
NM_000254
c.A2069G
c.A1001G
c.A2222G
p.K690R
p.K334R
p.K741R
28.3-Costa2023 E
BRSK2     Costa2023:P7-1chr11:
1475787-1475787
ACexonicDe novononsynonymous SNVNM_001256627
NM_001256629
NM_001256630
NM_001282218
NM_003957
c.A1617C
c.A1617C
c.A1755C
c.A1437C
c.A1617C
p.K539N
p.K539N
p.K585N
p.K479N
p.K539N
14.83-Costa2023 E
PNLIPRP3     Costa2023:P7-1chr10:
118202607-118202607
AGexonicDe novononsynonymous SNVNM_001011709c.A245Gp.Y82C14.7-Costa2023 E
DNAH11     Costa2023:P9-1chr7:
21584738-21584738
CTexonicDe novononsynonymous SNVNM_001277115c.C466Tp.L156F4.988-Costa2023 E
EVC     Costa2023:P9-1chr4:
5803701-5803701
GTexonicDe novostopgainNM_001306090
NM_153717
c.G2329T
c.G2329T
p.E777X
p.E777X
37.0-Costa2023 E
DGKB     Costa2023:P4-1chr7:
14722266-14722266
TAexonicDe novononsynonymous SNVNM_004080
NM_145695
c.A947T
c.A947T
p.N316I
p.N316I
23.3-Costa2023 E
TBL1X     Costa2023:P3-1chrX:
9656072-9656072
GAexonicDe novononsynonymous SNVNM_001139467
NM_001139466
NM_001139468
NM_005647
c.G220A
c.G373A
c.G220A
c.G373A
p.D74N
p.D125N
p.D74N
p.D125N
23.1-Costa2023 E
KRT76     Costa2023:P5-1chr12:
53165919-53165919
GAexonicDe novostopgainNM_015848c.C1096Tp.Q366X22.0-Costa2023 E
TMEM39B     Costa2023:P5-1chr1:
32557419-32557419
CTexonicDe novononsynonymous SNVNM_018056c.C734Tp.T245M22.71.0E-4Costa2023 E
PACS2     Costa2023:P15-1chr14:
105834449-105834449
GAexonicDe novononsynonymous SNVNM_001100913
NM_001243127
NM_015197
c.G625A
c.G424A
c.G625A
p.E209K
p.E142K
p.E209K
31.0-Costa2023 E
MSL2     Costa2023:P13-1chr3:
135870098-135870098
CAexonicDe novononsynonymous SNVNM_001145417
NM_018133
c.G1403T
c.G1625T
p.S468I
p.S542I
13.83-Costa2023 E
INPP5B     Costa2023:P16-1chr1:
38411952-38411952
GAexonicDe novononsynonymous SNVNM_005540c.C29Tp.T10M17.462.139E-5Costa2023 E
C15orf59     Costa2023:P15-1chr15:
74032592-74032592
CTexonicDe novononsynonymous SNVNM_001039614
NM_001303254
c.G548A
c.G464A
p.R183Q
p.R155Q
33.08.266E-6Costa2023 E
RGS11     Costa2023:P11-1chr16:
320762-320762
GCexonicDe novononsynonymous SNVNM_001286486
NM_001286485
NM_003834
NM_183337
c.C496G
c.C1015G
c.C985G
c.C1048G
p.L166V
p.L339V
p.L329V
p.L350V
7.369-Costa2023 E
KAT6A     Costa2023:P10-1chr8:
41798361-41798361
TCexonicDe novononsynonymous SNVNM_006766c.A3038Gp.K1013R13.73-Costa2023 E
MSL2     Costa2023:P13-1chr3:
135870081-135870081
CGexonicDe novononsynonymous SNVNM_001145417
NM_018133
c.G1420C
c.G1642C
p.V474L
p.V548L
9.955-Costa2023 E
CPOX     Costa2023:P13-1chr3:
98312071-98312071
AGexonicDe novononsynonymous SNVNM_000097c.T278Cp.F93S12.67-Costa2023 E
ZNF536     Costa2023:P24-1chr19:
30936040-30936040
GAexonicDe novostopgainNM_014717c.G1571Ap.W524X38.0-Costa2023 E
SPHKAP     Costa2023:P24-1chr2:
228855786-228855786
CTexonicDe novostopgainNM_030623
NM_001142644
c.G4802A
c.G4889A
p.W1601X
p.W1630X
44.0-Costa2023 E
LINS1     Costa2023:P28-1chr15:
101114236-101114236
GCexonicDe novononsynonymous SNVNM_001040616c.C842Gp.S281C13.395.789E-5Costa2023 E
FBXL5     Costa2023:P28-1chr4:
15627380-15627380
CTexonicDe novononsynonymous SNVNM_001193534
NM_001193535
NM_012161
c.G1342A
c.G1294A
c.G1345A
p.D448N
p.D432N
p.D449N
9.8416.592E-5Costa2023 E
CRAT     Costa2023:P17-1chr9:
131860864-131860864
TCexonicDe novononsynonymous SNVNM_000755
NM_001257363
c.A1151G
c.A1088G
p.N384S
p.N363S
17.63-Costa2023 E
KMO     Costa2023:P17-1chr1:
241725596-241725616
GTACATGGAGTTGACTATTCCGexonicDe novoframeshift deletionNM_003679c.580_599delp.Y194fs--Costa2023 E
TMEM221     Costa2023:P23-1chr19:
17547494-17547494
GAexonicDe novononsynonymous SNVNM_001190844c.C649Tp.R217W6.0278.427E-5Costa2023 E
ISLR2     Costa2023:P22-1chr15:
74426675-74426675
TAexonicDe novononsynonymous SNVNM_020851
NM_001130136
NM_001130137
NM_001130138
c.T1580A
c.T1580A
c.T1580A
c.T1580A
p.L527Q
p.L527Q
p.L527Q
p.L527Q
15.48-Costa2023 E
JAK3     Costa2023:P33-1chr19:
17949182-17949182
CTexonicDe novononsynonymous SNVNM_000215c.G1459Ap.V487M10.2-Costa2023 E
SLC16A8     Costa2023:P32-1chr22:
38477649-38477649
GCexonicDe novononsynonymous SNVNM_013356c.C396Gp.I132M16.01-Costa2023 E
CDH4     Costa2023:P33-1chr20:
60508149-60508149
GCexonicDe novononsynonymous SNVNM_001252338
NM_001252339
NM_001794
c.G2235C
c.G2124C
c.G2346C
p.K745N
p.K708N
p.K782N
8.624-Costa2023 E
PDK1     Costa2023:P31-1chr2:
173427015-173427015
TCexonicDe novononsynonymous SNVNM_001278549
NM_002610
c.T406C
c.T406C
p.Y136H
p.Y136H
6.775-Costa2023 E
ZBED4     Costa2023:P28-1chr22:
50278316-50278316
CGexonicDe novononsynonymous SNVNM_014838c.C1006Gp.R336G13.63-Costa2023 E
PLCL1     Costa2023:P32-1chr2:
199011526-199011526
AGexonicDe novononsynonymous SNVNM_006226c.A3128Gp.N1043S6.959-Costa2023 E
LUZP1     Costa2023:P32-1chr1:
23419553-23419553
CTexonicDe novononsynonymous SNVNM_001142546
NM_033631
c.G1202A
c.G1202A
p.R401Q
p.R401Q
18.911.648E-5Costa2023 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More