or
or
Exact

Results for "DENND1A"

Variant Events: 29

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
DENND1A     2-1266-003chr9:
126702568-126702582
GTCTCTCTCTCTCTCGTCTCTCTCTCTCintergenicDe novo--Yuen2017 G
DENND1A     2-1408-004chr9:
126735154-126735156
ATGAintergenicDe novo--Yuen2017 G
DENND1A     AU3790301chr9:
126210819-126210819
GTintronicDe novo--Yuen2017 G
DENND1A     2-1105-003chr9:
126208240-126208240
CTintronicDe novo--Yuen2017 G
DENND1A     31.s1chr9:
126164194-126164194
GAintronicDe novo--An2014 E
DENND1A     2-1138-003chr9:
126624913-126624913
ATintronicDe novo--Yuen2017 G
DENND1A     2-0285-004chr9:
126709120-126709125
GGATCAGintergenicDe novo--Yuen2017 G
DENND1A     2-1376-003chr9:
126709499-126709499
CTintergenicDe novo--Yuen2017 G
DENND1A     2-1132-003chr9:
126305912-126305912
CAintronicDe novo--Yuen2017 G
DENND1A     1-0629-003chr9:
126753234-126753234
GAintergenicDe novo--Yuen2017 G
DENND1A     1-0354-006chr9:
126345211-126345213
CAGCintronicDe novo--Yuen2017 G
DENND1A     1-0665-003chr9:
126636342-126636342
TCintronicDe novo--Yuen2017 G
DENND1A     2-1734-003chr9:
126734208-126734208
GAintergenicDe novo--Yuen2017 G
DENND1A     5-0017-004chr9:
126411692-126411692
TCintronicDe novo--Yuen2017 G
DENND1A     AU3076302chr9:
126706971-126706971
GAintergenicDe novo--Yuen2017 G
DENND1A     5-0084-003chr9:
126539211-126539211
GAintronicDe novo--Yuen2017 G
DENND1A     AU2139305chr9:
126182247-126182247
CTintronicDe novo--Yuen2017 G
DENND1A     AU3154301chr9:
126276826-126276826
GAintronicDe novo--Yuen2017 G
DENND1A     13066.p1chr9:
126458061-126458061
GAintronicDe novo--Werling2018 G
DENND1A     7-0032-003chr9:
126577603-126577603
TCintronicDe novo--Yuen2017 G
DENND1A     1-0155-003chr9:
126606293-126606293
CAintronicDe novo--Yuen2017 G
DENND1A     2-1341-003chr9:
126610460-126610460
AGintronicDe novo--Yuen2017 G
DENND1A     1-0010-005chr9:
126251648-126251648
GGACCTGGCintronicDe novo--Yuen2017 G
DENND1A     1-0539-003chr9:
126526182-126526182
GAintronicDe novo--Yuen2017 G
DENND1A     7-0194-003chr9:
126269655-126269655
AGintronicDe novo--Yuen2017 G
DENND1A     AU0636303chr9:
126685959-126685959
CTintronicDe novo--Yuen2017 G
DENND1A     AU3782303chr9:
126294564-126294564
TCintronicDe novo--Yuen2017 G
DENND1A     5-0050-004chr9:
126360099-126360099
GCintronicDe novo--Yuen2017 G
DENND1A     AU4032307chr9:
126538420-126538420
GAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More