or
or
Exact

Results for "KMT2C"

Variant Events: 206

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
KMT2C     PN400587chr7:
151962134-151962134
GTexonicUnknownstopgainNM_170606c.C1173Ap.C391X39.00.0294Leblond2019 E
KMT2C     Uddin2014:46chr7:
151842339-151842339
GTexonicDe novostopgainNM_170606c.C14073Ap.Y4691X55.01.65E-5Uddin2014 E
KMT2C     PN400284chr7:
151970859-151970859
CTexonicUnknownnonsynonymous SNVNM_170606c.G943Ap.G315S22.30.0832Leblond2019 E
KMT2C     PN400587chr7:
151970859-151970859
CTexonicUnknownnonsynonymous SNVNM_170606c.G943Ap.G315S22.30.0832Leblond2019 E
KMT2C     PN400523chr7:
151970859-151970859
CTexonicUnknownnonsynonymous SNVNM_170606c.G943Ap.G315S22.30.0832Leblond2019 E
KMT2C     PN400523chr7:
151962134-151962134
GTexonicUnknownstopgainNM_170606c.C1173Ap.C391X39.00.0294Leblond2019 E
KMT2C     PN400284chr7:
151962134-151962134
GTexonicUnknownstopgainNM_170606c.C1173Ap.C391X39.00.0294Leblond2019 E
KMT2C     PN400498chr7:
151962134-151962134
GTexonicUnknownstopgainNM_170606c.C1173Ap.C391X39.00.0294Leblond2019 E
KMT2C     09C80254chr7:
151868465-151868465
GAintronicDe novo-7.829E-5Satterstrom2020 E
Trost2022 G
KMT2C     AU4234302chr7:
152046129-152046129
GCintronicDe novo--Trost2022 G
Yuen2017 G
KMT2C     09C90854chr7:
151868351-151868351
GAexonicInheritedstopgainNM_170606c.C9451Tp.Q3151X51.0-Stessman2017 T
KMT2C     AU009503chr7:
151891590-151891590
CTexonicUnknownnonsynonymous SNVNM_170606c.G4442Ap.R1481Q24.81.648E-5Stessman2017 T
KMT2C     PN400367chr7:
151962134-151962134
GTexonicUnknownstopgainNM_170606c.C1173Ap.C391X39.00.0294Leblond2019 E
KMT2C     PN400524chr7:
151962134-151962134
GTexonicUnknownstopgainNM_170606c.C1173Ap.C391X39.00.0294Leblond2019 E
KMT2C     PN400551chr7:
151970859-151970859
CTexonicUnknownnonsynonymous SNVNM_170606c.G943Ap.G315S22.30.0832Leblond2019 E
KMT2C     PN400171chr7:
151962134-151962134
GTexonicUnknownstopgainNM_170606c.C1173Ap.C391X39.00.0294Leblond2019 E
KMT2C     PN400551chr7:
151962134-151962134
GTexonicUnknownstopgainNM_170606c.C1173Ap.C391X39.00.0294Leblond2019 E
KMT2C     PN400325chr7:
151962134-151962134
GTexonicUnknownstopgainNM_170606c.C1173Ap.C391X39.00.0294Leblond2019 E
KMT2C     M08110chr7:
151859603-151859603
TCexonicMaternalnonsynonymous SNVNM_170606c.A11059Gp.S3687G9.227-Guo2018 T
KMT2C     PN400412chr7:
151970859-151970859
CTexonicUnknownnonsynonymous SNVNM_170606c.G943Ap.G315S22.30.0832Leblond2019 E
KMT2C     M08383chr7:
151859588-151859588
CTexonicMaternalnonsynonymous SNVNM_170606c.G11074Ap.A3692T11.754.942E-5Guo2018 T
KMT2C     M23206chr7:
151860392-151860392
CTexonicMaternalnonsynonymous SNVNM_170606c.G10270Ap.A3424T20.47.413E-5Guo2018 T
KMT2C     M19805chr7:
151859998-151859998
GCexonicMaternalnonsynonymous SNVNM_170606c.C10664Gp.P3555R14.988.239E-6Guo2018 T
KMT2C     1-0447-003chr7:
151955583-151955624
TTTGTTGTTGTTGTTGTTGTTGCTGTTGTTGTTGTTGTTGTTTTTGTTGTTGTTGTTGTTGCTGTTGTTGTTGTTGTTGTTintronicDe novo--Yuen2017 G
KMT2C     M13373chr7:
151846011-151846011
CTexonicMaternalnonsynonymous SNVNM_170606c.G13001Ap.R4334Q19.672.541E-5Guo2018 T
KMT2C     M01833chr7:
151845498-151845498
AGexonicMaternalnonsynonymous SNVNM_170606c.T13514Cp.M4505T11.388.237E-6Guo2018 T
KMT2C     PN400412chr7:
151962134-151962134
GTexonicUnknownstopgainNM_170606c.C1173Ap.C391X39.00.0294Leblond2019 E
KMT2C     M20406chr7:
151848538-151848538
GCexonicMaternalnonsynonymous SNVNM_170606c.C12655Gp.L4219V0.280.0031Guo2018 T
KMT2C     M08572chr7:
151846069-151846069
CTexonicMaternalnonsynonymous SNVNM_170606c.G12943Ap.A4315T14.64-Guo2018 T
KMT2C     M21923chr7:
151874719-151874719
GAexonicMaternalnonsynonymous SNVNM_170606c.C7819Tp.P2607S3.856-Guo2018 T
KMT2C     M03443chr7:
151874542-151874542
CTexonicMaternalnonsynonymous SNVNM_170606c.G7996Ap.V2666I2.773-Guo2018 T
KMT2C     M13304chr7:
151874769-151874769
TCexonicMaternalnonsynonymous SNVNM_170606c.A7769Gp.H2590R12.89-Guo2018 T
KMT2C     M23149chr7:
151874749-151874749
GCexonicMaternalnonsynonymous SNVNM_170606c.C7789Gp.P2597A9.599-Guo2018 T
KMT2C     M20652chr7:
151873443-151873443
AGexonicMaternalnonsynonymous SNVNM_170606c.T9095Cp.M3032T7.6968.237E-6Guo2018 T
KMT2C     M21301chr7:
151864383-151864383
CTexonicMaternalnonsynonymous SNVNM_170606c.G9598Ap.E3200K20.51.648E-5Guo2018 T
KMT2C     M26740chr7:
151873605-151873605
CGexonicMaternalnonsynonymous SNVNM_170606c.G8933Cp.R2978T13.38-Guo2018 T
KMT2C     M12350chr7:
151873462-151873462
AGexonicMaternalnonsynonymous SNVNM_170606c.T9076Cp.S3026P6.461-Guo2018 T
KMT2C     M08473chr7:
151879084-151879084
GCexonicMaternalnonsynonymous SNVNM_170606c.C5861Gp.S1954C11.821.0E-4Guo2018 T
KMT2C     M15234chr7:
151879084-151879084
GCexonicMaternalnonsynonymous SNVNM_170606c.C5861Gp.S1954C11.821.0E-4Guo2018 T
KMT2C     M23076chr7:
151879262-151879262
TCexonicMaternalnonsynonymous SNVNM_170606c.A5683Gp.M1895V6.416.0E-4Guo2018 T
KMT2C     M27877chr7:
151879132-151879132
AGexonicMaternalnonsynonymous SNVNM_170606c.T5813Cp.M1938T0.16-Guo2018 T
KMT2C     M19761chr7:
151876975-151876975
CAexonicMaternalnonsynonymous SNVNM_170606c.G7386Tp.Q2462H13.81.647E-5Guo2018 T
KMT2C     11148.p1chr7:
151842339-151842339
GTexonicDe novostopgainNM_170606c.C14073Ap.Y4691X55.01.65E-5Iossifov2014 E
Ji2016 E
Kosmicki2017 E
O’Roak2012b E
Satterstrom2020 E
Willsey2013 E
Zhou2022 GE
KMT2C     M20740chr7:
151874940-151874940
TCexonicMaternalnonsynonymous SNVNM_170606c.A7598Gp.N2533S9.869-Guo2018 T
KMT2C     12742.p1chr7:
151845714-151845714
GAexonicDe novononsynonymous SNVNM_170606c.C13298Tp.A4433V20.1-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
Wilfert2021 G
Zhou2022 GE
KMT2C     M21549chr7:
151878905-151878905
CC/TexonicMaternal--Guo2018 T
KMT2C     11241.p1chr7:
151927315-151927315
GAexonicDe novononsynonymous SNVNM_170606c.C2861Tp.T954I15.7-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
KMT2C     AU1067302chr7:
151856028-151856028
GAexonicUnknownnonsynonymous SNVNM_170606c.C11590Tp.R3864C19.711.647E-5Stessman2017 T
KMT2C     M03593chr7:
151877190-151877190
TGexonicMaternalnonsynonymous SNVNM_170606c.A7171Cp.I2391L19.64.119E-5Guo2018 T
KMT2C     M19714chr7:
151947971-151947971
CGexonicMaternalnonsynonymous SNVNM_170606c.G1702Cp.G568R10.511.65E-5Guo2018 T
KMT2C     M18917chr7:
151896394-151896394
AGexonicMaternalnonsynonymous SNVNM_170606c.T4243Cp.S1415P13.53-Guo2018 T
KMT2C     SSC05690chr7:
151845714-151845714
GAexonicDe novononsynonymous SNVNM_170606c.C13298Tp.A4433V20.1-Fu2022 E
Lim2017 E
Trost2022 G
KMT2C     PN400262chr7:
151970859-151970859
CTexonicUnknownnonsynonymous SNVNM_170606c.G943Ap.G315S22.30.0832Leblond2019 E
KMT2C     M13338chr7:
152012244-152012244
CTexonicMaternalnonsynonymous SNVNM_170606c.G569Ap.R190Q14.74-Guo2018 T
KMT2C     PN400262chr7:
151962134-151962134
GTexonicUnknownstopgainNM_170606c.C1173Ap.C391X39.00.0294Leblond2019 E
KMT2C     M08611chr7:
151949694-151949694
ACexonicMaternalnonsynonymous SNVNM_170606c.T1406Gp.F469C17.168.3E-6Guo2018 T
KMT2C     M01763chr7:
151879404-151879404
ACexonicMaternalnonsynonymous SNVNM_170606c.T5541Gp.F1847L14.33-Guo2018 T
KMT2C     M21743chr7:
151879270-151879270
GAexonicMaternalnonsynonymous SNVNM_170606c.C5675Tp.P1892L8.577-Guo2018 T
KMT2C     M11415chr7:
151891184-151891184
AGexonicMaternalnonsynonymous SNVNM_170606c.T4570Cp.F1524L22.72.585E-5Guo2018 T
KMT2C     M13428chr7:
151880153-151880153
CAexonicMaternalnonsynonymous SNVNM_170606c.G5171Tp.S1724I14.119.884E-5Guo2018 T
KMT2C     AU076705chr7:
151858794-151858794
TAintronicDe novo--Trost2022 G
Yuen2017 G
KMT2C     PN400528chr7:
151970859-151970859
CTexonicUnknownnonsynonymous SNVNM_170606c.G943Ap.G315S22.30.0832Leblond2019 E
KMT2C     AU005023chr7:
151921255-151921255
CTexonicDe novostopgainNM_170606c.G3168Ap.W1056X40.0-Lim2017 E
KMT2C     PN400528chr7:
151962134-151962134
GTexonicUnknownstopgainNM_170606c.C1173Ap.C391X39.00.0294Leblond2019 E
KMT2C     More2023:19chr7:
151932996-151932996
CTexonicInheritednonsynonymous SNVNM_170606c.G2675Ap.G892E21.74.0E-4More2023 G
KMT2C     PN400477chr7:
151962134-151962134
GTexonicUnknownstopgainNM_170606c.C1173Ap.C391X39.00.0294Leblond2019 E
KMT2C     PN400477chr7:
151970859-151970859
CTexonicUnknownnonsynonymous SNVNM_170606c.G943Ap.G315S22.30.0832Leblond2019 E
KMT2C     1-0715-003chr7:
151974027-151974041
TAACAACAACAACAATAACAACAACAAintronicDe novo--Yuen2017 G
KMT2C     AU1885302chr7:
151949146-151949147
GTTexonicInheritedframeshift deletionNM_170606c.1499delCp.T500fs--Stessman2017 T
KMT2C     GX0306.p1chr7:
151859998-151859998
GCexonicPaternalnonsynonymous SNVNM_170606c.C10664Gp.P3555R14.988.239E-6Guo2018 T
KMT2C     PN400179chr7:
151970859-151970859
CTexonicUnknownnonsynonymous SNVNM_170606c.G943Ap.G315S22.30.0832Leblond2019 E
KMT2C     GX0489.p1chr7:
151851183-151851183
TGexonicPaternalnonsynonymous SNVNM_170606c.A12188Cp.Y4063S11.15-Guo2018 T
KMT2C     GX0344.p1chr7:
151874358-151874358
CTexonicPaternalnonsynonymous SNVNM_170606c.G8180Ap.G2727D16.24-Guo2018 T
KMT2C     GX0326.p1chr7:
151873443-151873443
AGexonicPaternalnonsynonymous SNVNM_170606c.T9095Cp.M3032T7.6968.237E-6Guo2018 T
KMT2C     PN400179chr7:
151962134-151962134
GTexonicUnknownstopgainNM_170606c.C1173Ap.C391X39.00.0294Leblond2019 E
KMT2C     GX0469.p1chr7:
151846191-151846191
GAexonicPaternalnonsynonymous SNVNM_170606c.C12821Tp.S4274F12.51-Guo2018 T
KMT2C     GX0177.p1chr7:
151845382-151845382
GAexonicPaternalnonsynonymous SNVNM_170606c.C13630Tp.R4544W14.148.238E-6Guo2018 T
KMT2C     GX0301.p1chr7:
151874907-151874907
TCexonicPaternalnonsynonymous SNVNM_170606c.A7631Gp.Q2544R7.5258.241E-6Guo2018 T
KMT2C     M30343chr7:
151874425-151874425
CGexonicPaternalnonsynonymous SNVNM_170606c.G8113Cp.E2705Q18.07-Guo2018 T
KMT2C     1-0755-003chr7:
151974027-151974041
TAACAACAACAACAATAACAACAACAAintronicDe novo--Yuen2017 G
KMT2C     GX0003.p1chr7:
151947971-151947971
CTexonicPaternalnonsynonymous SNVNM_170606c.G1702Ap.G568S9.8153.299E-5Guo2018 T
KMT2C     PN400480chr7:
151962134-151962134
GTexonicUnknownstopgainNM_170606c.C1173Ap.C391X39.00.0294Leblond2019 E
KMT2C     AU051504chr7:
151895049-151895049
TCintronicDe novo--Trost2022 G
Yuen2017 G
KMT2C     SP0117786chr7:
151845813-151845813
CTexonicDe novononsynonymous SNVNM_170606c.G13199Ap.R4400Q21.1-Trost2022 G
Zhou2022 GE
KMT2C     PN400480chr7:
151970859-151970859
CTexonicUnknownnonsynonymous SNVNM_170606c.G943Ap.G315S22.30.0832Leblond2019 E
KMT2C     SP0190586chr7:
151835928-151835928
GAexonicDe novononsynonymous SNVNM_170606c.C14596Tp.H4866Y16.28-Trost2022 G
Zhou2022 GE
KMT2C     SP0167673chr7:
151896469-151896469
CTexonicnonsynonymous SNVNM_170606c.G4168Ap.G1390R10.66-Zhou2022 GE
KMT2C     AU070703 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
KMT2C     SP0155911chr7:
151879601-151879601
GAexonicDe novostopgainNM_170606c.C5344Tp.Q1782X47.0-Trost2022 G
Zhou2022 GE
KMT2C     1-0485-003chr7:
151941952-151941958
TCTCACTTCTintronicDe novo--Yuen2017 G
KMT2C     PN400266chr7:
151970859-151970859
CTexonicUnknownnonsynonymous SNVNM_170606c.G943Ap.G315S22.30.0832Leblond2019 E
KMT2C     PN400505chr7:
151962134-151962134
GTexonicUnknownstopgainNM_170606c.C1173Ap.C391X39.00.0294Leblond2019 E
KMT2C     PN400505chr7:
151970859-151970859
CTexonicUnknownnonsynonymous SNVNM_170606c.G943Ap.G315S22.30.0832Leblond2019 E
KMT2C     PN400560chr7:
151970859-151970859
CTexonicUnknownnonsynonymous SNVNM_170606c.G943Ap.G315S22.30.0832Leblond2019 E
KMT2C     PN400560chr7:
151962134-151962134
GTexonicUnknownstopgainNM_170606c.C1173Ap.C391X39.00.0294Leblond2019 E
KMT2C     PN400532chr7:
151962134-151962134
GTexonicUnknownstopgainNM_170606c.C1173Ap.C391X39.00.0294Leblond2019 E
KMT2C     PN400532chr7:
151970859-151970859
CTexonicUnknownnonsynonymous SNVNM_170606c.G943Ap.G315S22.30.0832Leblond2019 E
KMT2C     2-1506-003chr7:
152087864-152087878
TACACACACACACACTACACACACACACintronicDe novo--Yuen2017 G
KMT2C     PN400484chr7:
151970859-151970859
CTexonicUnknownnonsynonymous SNVNM_170606c.G943Ap.G315S22.30.0832Leblond2019 E
KMT2C     PN400484chr7:
151836324-151836324
GTexonicUnknownnonsynonymous SNVNM_170606c.C14481Ap.F4827L21.0-Leblond2019 E
KMT2C     SP0087001chr7:
151868428-151868428
CTsplicingDe novosplicing15.63-Fu2022 E
Zhou2022 GE
KMT2C     SP0005799chr7:
151874147-151874147
CCTexonicDe novoframeshift insertionNM_170606c.8390dupAp.K2797fs-8.468E-5Fu2022 E
KMT2C     PN400533chr7:
151962134-151962134
GTexonicUnknownstopgainNM_170606c.C1173Ap.C391X39.00.0294Leblond2019 E
KMT2C     SP0007582chr7:
151843675-151843675
GAintronicDe novo--Fu2022 E
Trost2022 G
KMT2C     SP0043054chr7:
151833896-151833896
TGUTR3De novo--Fu2022 E
KMT2C     SP0062415chr7:
151896314-151896318
GATGTGintronicDe novo--Fu2022 E
KMT2C     SP0017378chr7:
151904421-151904421
CTexonicDe novononsynonymous SNVNM_170606c.G3805Ap.G1269S15.64-Fu2022 E
Zhou2022 GE
KMT2C     SP0133650chr7:
151947040-151947040
TCsplicingDe novosplicing8.834-Fu2022 E
Zhou2022 GE
KMT2C     SP0039899chr7:
151921108-151921108
TCexonicDe novosynonymous SNVNM_170606c.A3315Gp.Q1105Q--Fu2022 E
Zhou2022 GE
KMT2C     SP0101110chr7:
152012229-152012229
TCexonicDe novononsynonymous SNVNM_170606c.A584Gp.Q195R11.72-Fu2022 E
Trost2022 G
Zhou2022 GE
KMT2C     Krgovic2022:047960chr7:
151856031-151856033
GTGGexonicUnknownframeshift deletionNM_170606c.11585_11586delp.A3862fs--Krgovic2022 E
KMT2C     PN400564chr7:
151970859-151970859
CTexonicUnknownnonsynonymous SNVNM_170606c.G943Ap.G315S22.30.0832Leblond2019 E
KMT2C     M20711chr7:
151845915-151845915
ATexonicPaternalnonsynonymous SNVNM_170606c.T13097Ap.I4366N14.29-Guo2018 T
KMT2C     M21468chr7:
151843748-151843748
GAexonicPaternalnonsynonymous SNVNM_170606c.C13967Tp.A4656V11.478.252E-6Guo2018 T
KMT2C     M26912chr7:
151846108-151846108
GCexonicPaternalnonsynonymous SNVNM_170606c.C12904Gp.P4302A11.092.717E-5Guo2018 T
KMT2C     M17409chr7:
151846090-151846090
CC/TexonicPaternal--Guo2018 T
KMT2C     M16206chr7:
151843706-151843706
GAexonicPaternalnonsynonymous SNVNM_170606c.C14009Tp.A4670V19.456.605E-5Guo2018 T
KMT2C     M23185chr7:
151860622-151860622
TCexonicPaternalnonsynonymous SNVNM_170606c.A10040Gp.N3347S8.6343.0E-4Guo2018 T
KMT2C     M03623chr7:
151860131-151860131
CAexonicPaternalnonsynonymous SNVNM_170606c.G10531Tp.G3511C15.75-Guo2018 T
KMT2C     M23765chr7:
151873821-151873821
AGexonicPaternalnonsynonymous SNVNM_170606c.T8717Cp.I2906T3.712-Guo2018 T
KMT2C     M26948chr7:
151860779-151860779
TCexonicPaternalnonsynonymous SNVNM_170606c.A9883Gp.T3295A10.18.254E-6Guo2018 T
KMT2C     M20600chr7:
151849997-151849997
CTexonicPaternalnonsynonymous SNVNM_170606c.G12319Ap.V4107I17.968.237E-6Guo2018 T
KMT2C     M02223chr7:
151846108-151846108
GCexonicPaternalnonsynonymous SNVNM_170606c.C12904Gp.P4302A11.092.717E-5Guo2018 T
KMT2C     M23710chr7:
151856153-151856153
GAexonicPaternalnonsynonymous SNVNM_170606c.C11465Tp.T3822I15.01-Guo2018 T
KMT2C     M15016chr7:
151851183-151851183
TGexonicPaternalnonsynonymous SNVNM_170606c.A12188Cp.Y4063S11.15-Guo2018 T
KMT2C     M27882chr7:
151877190-151877190
TGexonicPaternalnonsynonymous SNVNM_170606c.A7171Cp.I2391L19.64.119E-5Guo2018 T
KMT2C     M15033chr7:
151877115-151877115
GAexonicPaternalnonsynonymous SNVNM_170606c.C7246Tp.H2416Y13.21-Guo2018 T
KMT2C     M08497chr7:
151878905-151878905
CC/TexonicPaternal--Guo2018 T
KMT2C     M18369chr7:
151878445-151878445
CTexonicPaternalnonsynonymous SNVNM_170606c.G6500Ap.R2167Q15.848.238E-6Guo2018 T
KMT2C     M08629chr7:
151876973-151876973
CTexonicPaternalnonsynonymous SNVNM_170606c.G7388Ap.R2463H16.297.0E-4Guo2018 T
KMT2C     M17478chr7:
151874926-151874926
GCexonicPaternalnonsynonymous SNVNM_170606c.C7612Gp.P2538A8.135-Guo2018 T
KMT2C     M20722chr7:
151877115-151877115
GAexonicPaternalnonsynonymous SNVNM_170606c.C7246Tp.H2416Y13.21-Guo2018 T
KMT2C     M19767chr7:
151876975-151876975
CAexonicPaternalnonsynonymous SNVNM_170606c.G7386Tp.Q2462H13.81.647E-5Guo2018 T
KMT2C     M20595chr7:
151949654-151949654
CGexonicPaternalnonsynonymous SNVNM_170606c.G1446Cp.M482I15.29-Guo2018 T
KMT2C     M16254chr7:
151948008-151948008
CTexonicPaternalnonsynonymous SNVNM_170606c.G1665Ap.M555I11.38.249E-6Guo2018 T
KMT2C     PN400565chr7:
151962134-151962134
GTexonicUnknownstopgainNM_170606c.C1173Ap.C391X39.00.0294Leblond2019 E
KMT2C     M08395chr7:
152012271-152012271
TCexonicPaternalnonsynonymous SNVNM_170606c.A542Gp.Y181C11.058.237E-6Guo2018 T
KMT2C     1-0358-003chr7:
151901210-151901210
ACintronicDe novo--Yuen2017 G
KMT2C     PN400512chr7:
151970859-151970859
CTexonicUnknownnonsynonymous SNVNM_170606c.G943Ap.G315S22.30.0832Leblond2019 E
KMT2C     PN400512chr7:
151962134-151962134
GTexonicUnknownstopgainNM_170606c.C1173Ap.C391X39.00.0294Leblond2019 E
KMT2C     2-1690-003chr7:
152016007-152016007
TCintronicDe novo--Trost2022 G
Yuen2017 G
KMT2C     GX0527.p1chr7:
151878033-151878033
CCTexonicMaternalframeshift insertionNM_170606c.6911_6912insAp.M2304fs--Guo2018 T
KMT2C     M01963 Complex Event; expand row to view variants  Unknownframeshift deletionNM_170606
NM_170606
c.6592_6593del
c.6593_6594del
p.R2198fs
p.R2198fs
--Guo2018 T
Wang2016 T
KMT2C     PN400108chr7:
151970859-151970859
CTexonicUnknownnonsynonymous SNVNM_170606c.G943Ap.G315S22.30.0832Leblond2019 E
KMT2C     PN400108chr7:
151962134-151962134
GTexonicUnknownstopgainNM_170606c.C1173Ap.C391X39.00.0294Leblond2019 E
KMT2C     11241_p1chr7:
151927315-151927315
GAexonicDe novononsynonymous SNVNM_170606c.C2861Tp.T954I15.7-Fu2022 E
KMT2C     PN400540chr7:
151970859-151970859
CTexonicUnknownnonsynonymous SNVNM_170606c.G943Ap.G315S22.30.0832Leblond2019 E
KMT2C     Disecmas_215Pchr7:
151879277-151879277
GGTexonicDe novoframeshift insertionNM_170606c.5667dupAp.R1890fs--Fu2022 E
KMT2C     EGAN00001101168chr7:
151859745-151859747
TTCTexonicDe novoframeshift deletionNM_170606c.10915_10916delp.E3639fs--Fu2022 E
KMT2C     DEASD_2088_001chr7:
151879426-151879426
GAexonicDe novononsynonymous SNVNM_170606c.C5519Tp.S1840F12.2-Fu2022 E
KMT2C     5328chr7:
151842339-151842339
GTexonicDe novostopgainNM_170606c.C14073Ap.Y4691X55.01.65E-5Fu2022 E
Trost2022 G
KMT2C     ASC_11394-1chr7:
151921117-151921117
TCexonicDe novosynonymous SNVNM_170606c.A3306Gp.Q1102Q-6.661E-5Fu2022 E
KMT2C     CC1080_202chr7:
151877921-151877921
TCexonicDe novononsynonymous SNVNM_170606c.A7024Gp.M2342V0.0219.066E-5Fu2022 E
KMT2C     DEASD_0012_001chr7:
151845251-151845251
CGexonicDe novononsynonymous SNVNM_170606c.G13761Cp.W4587C14.52-DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
KMT2C     PN400205chr7:
151970859-151970859
CTexonicUnknownnonsynonymous SNVNM_170606c.G943Ap.G315S22.30.0832Leblond2019 E
KMT2C     DEASD_0107_001chr7:
151932977-151932978
ACAexonicDe novoframeshift deletionNM_170606c.2693delGp.G898fs--DeRubeis2014 E
Kosmicki2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
KMT2C     PN400205chr7:
151962134-151962134
GTexonicUnknownstopgainNM_170606c.C1173Ap.C391X39.00.0294Leblond2019 E
KMT2C     1-0582-003chr7:
152087864-152087878
TACACACACACACACTACACACACACACintronicDe novo--Yuen2017 G
KMT2C     2-1245-003chr7:
151976585-151976588
TAAATAAAAintronicDe novo--Yuen2017 G
KMT2C     SP0127819 Complex Event; expand row to view variants  De novoframeshift deletion, frameshift substitution, nonsynonymous SNVNM_170606
NM_170606
NM_170606
c.11762delC
c.T11760G
c.11760_11762GG
p.A3921fs
p.F3920L
N/A
13.44-Antaki2022 GE
Trost2022 G
Zhou2022 GE
KMT2C     PN400542chr7:
151962134-151962134
GTexonicUnknownstopgainNM_170606c.C1173Ap.C391X39.00.0294Leblond2019 E
KMT2C     SP0033305chr7:
151841811-151841811
CTexonicnonsynonymous SNVNM_170606c.G14330Ap.R4777Q26.08.274E-6Antaki2022 GE
Zhou2022 GE
KMT2C     PN400113chr7:
151970859-151970859
CTexonicUnknownnonsynonymous SNVNM_170606c.G943Ap.G315S22.30.0832Leblond2019 E
KMT2C     PN400113chr7:
151962134-151962134
GTexonicUnknownstopgainNM_170606c.C1173Ap.C391X39.00.0294Leblond2019 E
KMT2C     M02033chr7:
151884896-151884896
ATexonicDe novononsynonymous SNVNM_170606c.T4697Ap.I1566N18.92-Guo2018 T
KMT2C     AU4235303chr7:
151831266-151831266
TGdownstreamDe novo--Trost2022 G
Yuen2017 G
KMT2C     GX0516.p1chr7:
151949171-151949171
CAexonicDe novononsynonymous SNVNM_170606c.G1474Tp.V492F14.73-Guo2018 T
KMT2C     PN400579chr7:
151962134-151962134
GTexonicUnknownstopgainNM_170606c.C1173Ap.C391X39.00.0294Leblond2019 E
KMT2C     Ishay2021:17chr7:
151873293-151873293
GAexonicInheritednonsynonymous SNVNM_170606c.C9245Tp.P3082L17.180.0045Ishay2021 E
KMT2C     PN400491chr7:
151962134-151962134
GTexonicUnknownstopgainNM_170606c.C1173Ap.C391X39.00.0294Leblond2019 E
KMT2C     PN400491chr7:
151970859-151970859
CTexonicUnknownnonsynonymous SNVNM_170606c.G943Ap.G315S22.30.0832Leblond2019 E
KMT2C     XJ500_XC485chr7:
151878327-151878328
AGAexonicDe novoframeshift deletionNM_170606c.6617delCp.P2206fs--Satterstrom2020 E
Trost2022 G
Zhou2022 GE
KMT2C     HN0043.p1chr7:
151856042-151856042
TCexonicMaternalnonsynonymous SNVNM_170606c.A11576Gp.E3859G16.96-Guo2018 T
KMT2C     M30618chr7:
151855985-151855985
AGexonicMaternalnonsynonymous SNVNM_170606c.T11633Cp.M3878T15.25-Guo2018 T
KMT2C     GX0281.p1chr7:
151873816-151873816
ATexonicMaternalnonsynonymous SNVNM_170606c.T8722Ap.S2908T8.1818.24E-6Guo2018 T
KMT2C     GX0358.p1chr7:
151859564-151859564
CTexonicMaternalnonsynonymous SNVNM_170606c.G11098Ap.A3700T10.498.237E-6Guo2018 T
KMT2C     GX0311.p1chr7:
151853118-151853118
GCexonicMaternalnonsynonymous SNVNM_170606c.C11837Gp.P3946R10.7-Guo2018 T
KMT2C     GX0074.p1chr7:
151879294-151879294
GAexonicMaternalnonsynonymous SNVNM_170606c.C5651Tp.P1884L16.62-Guo2018 T
KMT2C     04C36010chr7:
151949721-151949722
TATexonicDe novoframeshift deletionNM_170606c.1378delTp.Y460fs--Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
KMT2C     HN0030.p1chr7:
151877157-151877157
CTexonicMaternalnonsynonymous SNVNM_170606c.G7204Ap.G2402S12.29-Guo2018 T
KMT2C     GX0434.p1chr7:
151949068-151949068
CC/TexonicMaternal--Guo2018 T
KMT2C     HN0099.p1chr7:
151948024-151948024
CTexonicMaternalnonsynonymous SNVNM_170606c.G1649Ap.G550D11.638.255E-6Guo2018 T
KMT2C     GX0083.p1chr7:
151873887-151873887
CTexonicMaternalnonsynonymous SNVNM_170606c.G8651Ap.R2884Q0.6393.296E-5Guo2018 T
KMT2C     GX0224.p1chr7:
151873816-151873816
ATexonicMaternalnonsynonymous SNVNM_170606c.T8722Ap.S2908T8.1818.24E-6Guo2018 T
KMT2C     M30901chr7:
151873990-151873990
CTexonicMaternalnonsynonymous SNVNM_170606c.G8548Ap.D2850N0.3068.237E-6Guo2018 T
KMT2C     M31959chr7:
151873990-151873990
CTexonicMaternalnonsynonymous SNVNM_170606c.G8548Ap.D2850N0.3068.237E-6Guo2018 T
KMT2C     mAGRE5901chr7:
151868351-151868351
GAexonicDe novostopgainNM_170606c.C9451Tp.Q3151X51.0-Cirnigliaro2023 G
KMT2C     13897.p1chr7:
151836804-151836804
GCexonicMosaicnonsynonymous SNVNM_170606c.C14416Gp.R4806G13.46-Dou2017 E
Krupp2017 E
KMT2C     M30340chr7:
152055717-152055717
TAexonicMaternalnonsynonymous SNVNM_170606c.A205Tp.M69L17.135.766E-5Guo2018 T
KMT2C     PN400321chr7:
151962134-151962134
GTexonicUnknownstopgainNM_170606c.C1173Ap.C391X39.00.0294Leblond2019 E
KMT2C     2-1781-003chr7:
151881150-151881150
TCintronicDe novo--Trost2022 G
KMT2C     REACH000233chr7:
152015002-152015002
GAintronicDe novo--Trost2022 G
KMT2C     1-0750-003chr7:
152017059-152017059
GAintronicDe novo--Trost2022 G
KMT2C     AU2310301chr7:
152009248-152009248
GCintronicDe novo--Trost2022 G
KMT2C     1-1183-003chr7:
152014439-152014439
CGintronicDe novo--Trost2022 G
KMT2C     PN400215chr7:
151970859-151970859
CTexonicUnknownnonsynonymous SNVNM_170606c.G943Ap.G315S22.30.0832Leblond2019 E
KMT2C     SP0060430chr7:
151962055-151962055
CTintronicDe novo--Trost2022 G
KMT2C     MSSNG00362-003chr7:
151999656-151999656
TCintronicDe novo--Trost2022 G
KMT2C     1-1112-003chr7:
151934526-151934526
GAintronicDe novo--Trost2022 G
KMT2C     5-5083-003chr7:
151950485-151950485
TCintronicDe novo--Trost2022 G
KMT2C     AU0452303chr7:
152102425-152102425
GAintronicDe novo--Trost2022 G
KMT2C     REACH000026chr7:
152081670-152081670
CAintronicDe novo--Trost2022 G
KMT2C     1-0182-003chr7:
152097752-152097752
TTAAintronicDe novo--Trost2022 G
KMT2C     PN400259chr7:
151962134-151962134
GTexonicUnknownstopgainNM_170606c.C1173Ap.C391X39.00.0294Leblond2019 E
KMT2C     1-0446-003chr7:
152062570-152062570
GAintronicDe novo--Trost2022 G
Yuen2017 G
KMT2C     4G659chr7:
151845723-151845723
ACexonicDe novononsynonymous SNVNM_170606c.T13289Gp.L4430W16.77-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More