or
or
Exact

Results for "SHANK2"

Variant Events: 166

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SHANK2     2-1129-003 Complex Event; expand row to view variants  De novo--Yuen2016 G
Yuen2017 G
SHANK2     1-0677-003chr11:
70380022-70380022
CGintronicDe novo--Yuen2017 G
SHANK2     2-1459-003chr11:
70386149-70386149
AGintronicDe novo--Yuen2016 G
Yuen2017 G
SHANK2     7-0174-003chr11:
71018656-71018656
TGintergenicDe novo--Yuen2017 G
SHANK2     1-0253-004chr11:
70380896-70380896
CTintronicDe novo--Yuen2017 G
SHANK2     ITAN_2176chr11:
70348920-70348920
GAexonicMaternalsynonymous SNVNM_133266c.C414Tp.D138D3.697-Wang2020 T
SHANK2     HN0112.p1chr11:
70507786-70507786
GCexonicDe novostopgainNM_133266c.C87Gp.Y29X37.0-Guo2018 T
SHANK2     1-0530-003chr11:
71034073-71034073
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
SHANK2     3-0458-000Bchr11:
71003796-71003796
TCintergenicDe novo--Yuen2017 G
SHANK2     12380.p1chr11:
70332092-70332094
CTGCexonicUnknown, De novoframeshift deletionNM_133266c.2540_2541delp.S847fs--Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wang2020 T
Wilfert2021 G
Willsey2013 E
SHANK2     AU4433301chr11:
70647236-70647236
ACintronicDe novo--Yuen2017 G
SHANK2     1-0169-004chr11:
70515179-70515179
AGintronicDe novo--Yuen2017 G
SHANK2     HEN0141.p1chr11:
70644650-70644650
CTexonicMaternalunknown29.54.993E-5Guo2018 T
SHANK2     1-0441-003chr11:
70336411-70336411
GAexonicDe novostopgainNM_133266c.C757Tp.R253X24.1-Wang2020 T
Yuen2016 G
Yuen2017 G
SHANK2     2-1391-004chr11:
70445947-70445948
AGAintronicDe novo--Yuen2017 G
SHANK2     74-0115chr11:
71103740-71103740
ACintergenicDe novo--Michaelson2012 G
SHANK2     AU4336301chr11:
70818978-70818978
GAintronicDe novo--Yuen2017 G
SHANK2     M15036chr11:
70332552-70332552
GAexonicInheritedsynonymous SNVNM_133266c.C2082Tp.Y694Y-3.298E-5Stessman2017 T
SHANK2     M08903chr11:
70332422-70332422
TCexonicPaternalnonsynonymous SNVNM_133266c.A2212Gp.N738D0.0018.24E-6Guo2018 T
SHANK2     M19792chr11:
70332329-70332329
CTexonicPaternalnonsynonymous SNVNM_133266c.G2305Ap.G769S12.692.477E-5Guo2018 T
SHANK2     HEN0344.p1chr11:
70666542-70666542
GAexonicMaternalunknown21.0-Guo2018 T
SHANK2     HEN0080.p1chr11:
70666515-70666515
CTexonicMaternalunknown11.14-Guo2018 T
SHANK2     HEN0031.p1chr11:
70829919-70829919
GAexonicMaternalunknown15.74.813E-5Guo2018 T
SHANK2     HEN0214.p1chr11:
70805714-70805714
CTexonicMaternalunknown13.984.529E-5Guo2018 T
SHANK2     M08656chr11:
70824391-70824391
AA/GexonicPaternal--Guo2018 T
SHANK2     SF0136425.p1chr11:
70336493-70336493
CTsplicingsplicing17.85-Wang2020 T
SHANK2     M20665chr11:
70824356-70824356
CTexonicPaternalunknown14.33-Guo2018 T
SHANK2     M08500chr11:
70858195-70858195
GAexonicPaternalunknown13.171.0E-4Guo2018 T
SHANK2     1-0019-004chr11:
70416269-70416269
CTintronicDe novo--Yuen2017 G
SHANK2     M08440chr11:
70824391-70824391
AA/GexonicPaternal--Guo2018 T
SHANK2     M23785chr11:
70333178-70333178
CTexonicPaternalnonsynonymous SNVNM_133266c.G1456Ap.V486I11.883.471E-5Guo2018 T
SHANK2     M01813chr11:
70332639-70332639
CGexonicPaternalnonsynonymous SNVNM_133266c.G1995Cp.M665I12.178.25E-6Guo2018 T
SHANK2     M15191chr11:
70666751-70666751
CTexonicPaternalunknown16.13-Guo2018 T
SHANK2     M17534chr11:
70507806-70507806
AGexonicPaternalnonsynonymous SNVNM_133266c.T67Cp.C23R13.26-Guo2018 T
SHANK2     AU2019302chr11:
70810949-70810949
GAintronicDe novo--Yuen2017 G
SHANK2     M17580chr11:
70666719-70666719
GAexonicMaternal, Unknownunknown20.2-Guo2018 T
Stessman2017 T
SHANK2     3-0456-000chr11:
70544556-70544556
CTintronicDe novo--Yuen2016 G
Yuen2017 G
SHANK2     ACGC_M30889chr11:
70666755-70666755
GAexonicPaternalunknown21.11.0E-4Wang2020 T
SHANK2     SP0062760chr11:
70507825-70507825
CTexonicDe novosynonymous SNVNM_133266c.G48Ap.T16T10.844.119E-5Fu2022 E
SHANK2     AU071703chr11:
70803515-70803515
CTexonicUnknownunknown24.64.601E-5Stessman2017 T
SHANK2     AU054304chr11:
70769891-70769891
CTintronicDe novo--Yuen2017 G
SHANK2     ACGC_M15191chr11:
70666751-70666751
CTexonicPaternalunknown16.13-Wang2020 T
SHANK2     SP0136425chr11:
70336493-70336493
CTsplicingDe novosplicing17.85-Fu2022 E
SHANK2     SP0048613chr11:
70333544-70333544
AAGTACATCCCCTTCTCCCTCATCATGGTGexonicDe novoframeshift insertionNM_133266c.1089_1090insCACCATGATGAGGGAGAAGGGGATGTACp.F364fs--Fu2022 E
SHANK2     2-0198-005chr11:
70959668-70959668
GAintergenicDe novo--Yuen2017 G
SHANK2     ACGC_M15036chr11:
70332552-70332552
GAexonicUnknownsynonymous SNVNM_133266c.C2082Tp.Y694Y-3.298E-5Wang2020 T
SHANK2     AU2075301chr11:
70799643-70799643
GAintronicDe novo--Yuen2017 G
SHANK2     Leuven2_60356400chr11:
70666548-70666548
GAexonicUnknownunknown17.19-Wang2020 T
SHANK2     Leuven_405458chr11:
70666548-70666548
GAexonicUnknownunknown17.19-Wang2020 T
SHANK2     1-0075-003chr11:
70697001-70697001
CTintronicDe novo--Yuen2017 G
SHANK2     M21695chr11:
70333110-70333110
CAexonicInherited, Paternalnonsynonymous SNVNM_133266c.G1524Tp.R508S15.87-Guo2018 T
Stessman2017 T
SHANK2     PN400501chr11:
70644619-70644619
CTexonicUnknownunknown24.20.0049Leblond2019 E
SHANK2     14015.p1chr11:
70533721-70533721
TGintronicDe novo--Turner2016 G
SHANK2     PN400514chr11:
70644619-70644619
CTexonicUnknownunknown24.20.0049Leblond2019 E
SHANK2     AGRE_AU071703chr11:
70803515-70803515
CTexonicUnknownunknown24.64.601E-5Wang2020 T
SHANK2     AGRE_03C16378chr11:
70803515-70803515
CTexonicUnknownunknown24.64.601E-5Wang2020 T
SHANK2     Radboud_10-10578chr11:
70644587-70644587
CTexonicPaternalunknown20.35.012E-5Wang2020 T
SHANK2     10004871007410237-Cchr11:
70653185-70653186
TCTexonicDe novounknown--Fu2022 E
SHANK2     AU3632301chr11:
70796081-70796081
CTintronicDe novo--Yuen2017 G
SHANK2     Radboud_10-10576chr11:
70644587-70644587
CTexonicPaternalunknown20.35.012E-5Wang2020 T
SHANK2     2-0298-003chr11:
70377333-70377333
AGintronicDe novo--Yuen2017 G
SHANK2     PN400279chr11:
70644619-70644619
CTexonicUnknownunknown24.20.0049Leblond2019 E
SHANK2     1-0455-004chr11:
70330136-70330136
AGintronicDe novo--Yuen2017 G
SHANK2     ACGC_HEN0004.p1chr11:
70332546-70332546
GAexonicUnknownsynonymous SNVNM_133266c.C2088Tp.T696T-8.243E-6Wang2020 T
SHANK2     AU1940304chr11:
70463170-70463176
CTGAGTGCTGintronicDe novo--Yuen2017 G
SHANK2     08C74824chr11:
70653238-70653238
GAexonicDe novounknown14.44-Fu2022 E
SHANK2     GEA430chr11:
70798895-70798895
CCGintronicDe novo-9.076E-5Fu2022 E
SHANK2     HEN0361.p1chr11:
70332577-70332577
CTexonicPaternalnonsynonymous SNVNM_133266c.G2057Ap.R686K12.853.301E-5Guo2018 T
SHANK2     M03813chr11:
70332898-70332898
CTexonicMaternalnonsynonymous SNVNM_133266c.G1736Ap.G579D3.12-Guo2018 T
SHANK2     3-0456-000Bchr11:
70544556-70544556
CTintronicDe novo--Yuen2017 G
SHANK2     TASC_219-2325-0001chr11:
70338495-70338495
GAexonicUnknownnonsynonymous SNVNM_133266c.C620Tp.A207V20.68.396E-6Wang2020 T
SHANK2     M19664chr11:
70821045-70821045
CAexonicMaternalunknown12.27-Guo2018 T
SHANK2     M08314chr11:
70803628-70803628
AGexonicMaternalunknown15.42-Guo2018 T
SHANK2     3-0458-000chr11:
71003796-71003796
TCintergenicDe novo--Yuen2016 G
SHANK2     M20738chr11:
70824391-70824391
AA/GexonicMaternal--Guo2018 T
SHANK2     M23679chr11:
70336459-70336459
TGexonicMaternalnonsynonymous SNVNM_133266c.A709Cp.T237P9.687-Guo2018 T
SHANK2     TASC_211-5435-4chr11:
70666749-70666749
GAexonicUnknownunknown18.94-Wang2020 T
SHANK2     M16089chr11:
70333178-70333178
CTexonicMaternalnonsynonymous SNVNM_133266c.G1456Ap.V486I11.883.471E-5Guo2018 T
SHANK2     Leuven_299053chr11:
70666749-70666749
GAexonicUnknownunknown18.94-Wang2020 T
SHANK2     M08485chr11:
70346692-70346692
GAexonicMaternalnonsynonymous SNVNM_133266c.C527Tp.S176L17.49-Guo2018 T
SHANK2     M08515chr11:
70336459-70336459
TGexonicMaternalnonsynonymous SNVNM_133266c.A709Cp.T237P9.687-Guo2018 T
SHANK2     ACGC_HN0112.p1chr11:
70507786-70507786
GCexonicDe novostopgainNM_133266c.C87Gp.Y29X37.0-Wang2020 T
SHANK2     HEN0171.p1chr11:
70805627-70805627
CTexonicUnknownunknown20.2-Guo2018 T
SHANK2     2-1207-003chr11:
70716492-70716492
GAintronicDe novo--Yuen2016 G
Yuen2017 G
SHANK2     PN400515chr11:
70644619-70644619
CTexonicUnknownunknown24.20.0049Leblond2019 E
SHANK2     Gecz4_48759chr11:
70805627-70805627
CTexonicUnknownunknown20.2-Wang2020 T
SHANK2     ACGC_HEN0171.p1chr11:
70805627-70805627
CTexonicUnknownunknown20.2-Wang2020 T
SHANK2     108070-100chr11:
70803488-70803488
CGexonicUnknownunknown26.2-Stessman2017 T
SHANK2     2-0198-003chr11:
70568291-70568291
GAintronicDe novo--Yuen2017 G
SHANK2     AU3951301chr11:
70474718-70474718
GAintronicDe novo--Yuen2017 G
SHANK2     2-1508-003chr11:
70680877-70680877
CTintronicDe novo--Yuen2017 G
SHANK2     M32289chr11:
70829927-70829927
CTexonicMaternalunknown33.04.741E-5Guo2018 T
SHANK2     Ishay2021:30chr11:
70653185-70653186
TCTexonicDe novounknown--Ishay2021 E
SHANK2     2-1131-003chr11:
71114941-71114941
CGintergenicDe novo--Yuen2017 G
SHANK2     AU4467302chr11:
71053450-71053450
CTintergenicDe novo--Yuen2017 G
SHANK2     2-0299-003chr11:
70512026-70512026
CTintronicDe novo--Yuen2017 G
SHANK2     HN0074.p1chr11:
70332443-70332443
CTexonicPaternalnonsynonymous SNVNM_133266c.G2191Ap.V731M17.178.24E-6Guo2018 T
SHANK2     GX0325.p1chr11:
70336401-70336401
AGexonicPaternalnonsynonymous SNVNM_133266c.T767Cp.M256T15.988.243E-6Guo2018 T
SHANK2     HN0037.p1chr11:
70332912-70332912
CGexonicPaternalnonsynonymous SNVNM_133266c.G1722Cp.E574D6.322-Guo2018 T
SHANK2     Leuven_305385chr11:
70505962-70505962
CTexonicUnknownnonsynonymous SNVNM_133266c.G268Ap.G90R32.01.65E-5Wang2020 T
SHANK2     1-0277-003chr11:
70319333-70319333
CTexonicDe novononsynonymous SNVNM_133266c.G3427Ap.A1143T7.19-Wang2020 T
Yuen2017 G
SHANK2     PN400483chr11:
70644619-70644619
CTexonicUnknownunknown24.20.0049Leblond2019 E
SHANK2     GX0441.p1chr11:
70821058-70821058
CC/TexonicPaternal--Guo2018 T
SHANK2     AGRE_AU1644303chr11:
70805647-70805647
CTexonicUnknownunknown27.34.604E-5Wang2020 T
SHANK2     AGRE_AU1181303chr11:
70348922-70348922
CTexonicUnknownnonsynonymous SNVNM_133266c.G412Ap.D138N22.58.332E-6Wang2020 T
SHANK2     03C16187chr11:
70348919-70348919
CTexonicUnknownnonsynonymous SNVNM_133266c.G415Ap.D139N18.898.389E-6Stessman2017 T
SHANK2     AGRE_03C16187chr11:
70348919-70348919
CTexonicUnknownnonsynonymous SNVNM_133266c.G415Ap.D139N18.898.389E-6Wang2020 T
SHANK2     1-0104-003chr11:
70914484-70914492
ATAAAGGGTAintronicDe novo--Yuen2017 G
SHANK2     M32019chr11:
70666515-70666515
CC/TexonicPaternal--Guo2018 T
SHANK2     ACGC_HEN0059.p1chr11:
70332687-70332688
CTCexonicUnknownframeshift deletionNM_133266c.1946delAp.E649fs--Wang2020 T
SHANK2     GX0409.p1chr11:
70507869-70507869
TCexonicPaternalnonsynonymous SNVNM_133266c.A4Gp.M2V15.77-Guo2018 T
SHANK2     ACGC_GX0546.p1chr11:
70332687-70332688
CTCexonicUnknownframeshift deletionNM_133266c.1946delAp.E649fs--Wang2020 T
SHANK2     M30889chr11:
70666755-70666755
GA/GexonicPaternal--Guo2018 T
SHANK2     Leuven2_82947565chr11:
70338480-70338480
CGexonicUnknownnonsynonymous SNVNM_133266c.G635Cp.R212P29.82.538E-5Wang2020 T
SHANK2     GX0233.p1chr11:
70666746-70666746
GA/GexonicPaternal--Guo2018 T
SHANK2     ACGC_HEN0078.p1chr11:
70332687-70332688
CTCexonicUnknownframeshift deletionNM_133266c.1946delAp.E649fs--Wang2020 T
SHANK2     08C74281chr11:
70319333-70319333
CTexonicDe novononsynonymous SNVNM_133266c.G3427Ap.A1143T7.19-Fu2022 E
Satterstrom2020 E
SHANK2     ACGC_HEN0243.p1chr11:
70332333-70332333
GAexonicUnknownsynonymous SNVNM_133266c.C2301Tp.T767T-1.651E-5Wang2020 T
SHANK2     Leuven_393327chr11:
70666591-70666591
GAexonicUnknownunknown-3.0E-4Wang2020 T
SHANK2     03C16378chr11:
70803515-70803515
CTexonicUnknownunknown24.64.601E-5Stessman2017 T
SHANK2     ACGC_M32301chr11:
70666569-70666569
CTexonicUnknownunknown15.31-Wang2020 T
SHANK2     PN400317chr11:
70824387-70824387
ATexonicUnknownunknown18.290.0046Leblond2019 E
SHANK2     AGRE_AU0906301chr11:
70505950-70505950
CTexonicUnknownnonsynonymous SNVNM_133266c.G280Ap.G94R26.28.253E-6Wang2020 T
SHANK2     ACGC_HEN0333.p1chr11:
70332852-70332852
GAexonicUnknownsynonymous SNVNM_133266c.C1782Tp.P594P-1.72E-5Wang2020 T
SHANK2     AU027506chr11:
70413227-70413230
CGGGCGGintronicDe novo--Yuen2017 G
SHANK2     ACGC_M31992chr11:
70666569-70666569
CTexonicUnknownunknown15.31-Wang2020 T
SHANK2     3-0458-000Achr11:
71003796-71003796
TCintergenicDe novo--Yuen2017 G
SHANK2     AU3905301chr11:
70569568-70569568
CTintronicDe novo--Yuen2017 G
SHANK2     1-0273-004chr11:
70546281-70546281
CTintronicDe novo--Yuen2017 G
SHANK2     AU066403chr11:
70908689-70908689
GAintronicDe novo--Yuen2017 G
SHANK2     2-0145-004chr11:
70483437-70483437
CTintronicDe novo--Yuen2017 G
SHANK2     1-0936-003chr11:
70697189-70697189
GAintronicDe novo--Yuen2017 G
SHANK2     PN400267chr11:
70824387-70824387
ATexonicUnknownunknown18.290.0046Leblond2019 E
SHANK2     ACGC_HEN0344.p1chr11:
70666542-70666542
GAexonicMaternalunknown21.0-Wang2020 T
SHANK2     PN400321chr11:
70824387-70824387
ATexonicUnknownunknown18.290.0046Leblond2019 E
SHANK2     ACGC_HEN0141.p1chr11:
70644650-70644650
CTexonicMaternalunknown29.54.993E-5Wang2020 T
SHANK2     ACGC_M17580chr11:
70666719-70666719
GAexonicMaternalunknown20.2-Wang2020 T
SHANK2     2-0214-004chr11:
71038934-71038934
ATintergenicDe novo--Yuen2017 G
SHANK2     GX0379.p1chr11:
70332529-70332529
CTexonicUnknownnonsynonymous SNVNM_133266c.G2105Ap.R702Q9.6164.121E-5Guo2018 T
SHANK2     AU3801301chr11:
70753191-70753191
CTintronicDe novo--Yuen2017 G
SHANK2     3-0431-000chr11:
70899650-70899650
CTintronicDe novo--Yuen2016 G
Yuen2017 G
SHANK2     ITAN_2428chr11:
70829955-70829955
GAexonicMaternalunknown17.81-Wang2020 T
SHANK2     ITAN_1435chr11:
70644617-70644617
CTexonicMaternalunknown32.0-Wang2020 T
SHANK2     Leuven2_60356116chr11:
70829916-70829916
CTexonicUnknownunknown31.0-Wang2020 T
SHANK2     AU3124302chr11:
70491419-70491419
GAintronicDe novo--Yuen2017 G
SHANK2     Leuven_85885770chr11:
70824394-70824394
CTexonicUnknownunknown31.0-Wang2020 T
SHANK2     10C108736chr11:
70336411-70336411
GAexonicDe novostopgainNM_133266c.C757Tp.R253X24.1-Fu2022 E
Satterstrom2020 E
SHANK2     SAGE_BK831-01chr11:
70829966-70829966
GAexonicUnknownunknown26.7-Wang2020 T
SHANK2     AU2100302chr11:
70401856-70401856
GAintronicDe novo--Yuen2017 G
SHANK2     2-0310-003chr11:
71037590-71037590
GAintergenicDe novo--Yuen2017 G
SHANK2     GX0432.p1chr11:
70332470-70332470
AA/CexonicMaternal--Guo2018 T
SHANK2     ACGC_M21695chr11:
70333110-70333110
CAexonicUnknownnonsynonymous SNVNM_133266c.G1524Tp.R508S15.87-Wang2020 T
SHANK2     Leuven_300450chr11:
70829982-70829982
CTexonicUnknownunknown27.1-Wang2020 T
SHANK2     2-0198-004chr11:
70959668-70959668
GAintergenicDe novo--Yuen2017 G
SHANK2     AU071203chr11:
70559756-70559756
GAintronicDe novo--Yuen2017 G
SHANK2     PN400486chr11:
70644619-70644619
CTexonicUnknownunknown24.20.0049Leblond2019 E
SHANK2     1-0464-003chr11:
71113580-71113580
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
SHANK2     GX0430.p1chr11:
70805614-70805614
GC/GexonicMaternal--Guo2018 T
SHANK2     GX0444.p1chr11:
70332709-70332709
GCexonicMaternalnonsynonymous SNVNM_133266c.C1925Gp.S642C9.744-Guo2018 T
SHANK2     GX0240.p1chr11:
70858251-70858251
GA/GexonicMaternal--Guo2018 T
SHANK2     GX0358.p1chr11:
70830059-70830059
GC/GexonicMaternal--Guo2018 T
SHANK2     219-2325-0001chr11:
70338495-70338495
GAexonicUnknownnonsynonymous SNVNM_133266c.C620Tp.A207V20.68.396E-6Stessman2017 T
SHANK2     2-1303-003chr11:
70505417-70505417
CTintronicDe novo--Yuen2017 G
SHANK2     PN400380chr11:
70644619-70644619
CTexonicUnknownunknown24.20.0049Leblond2019 E
SHANK2     1-0197-004chr11:
70546607-70546607
CTintronicDe novo--Yuen2017 G
SHANK2     171-08-109761chr11:
70332049-70332049
GTexonicDe novostopgainNM_133266c.C2585Ap.S862X39.0-Satterstrom2020 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More