or
or
Exact

Results for "SYNGAP1"

Variant Events: 88

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SYNGAP1     08C77304chr6:
33411384-33411384
CTexonicUnknownnonsynonymous SNVNM_006772c.C3055Tp.R1019C16.893.303E-5Stessman2017 T
SYNGAP1     PN400508chr6:
33419613-33419615
CAGCexonicUnknownframeshift deletionNM_006772c.3963_3964delp.P1321fs-0.0037Leblond2019 E
SYNGAP1     M02073chr6:
33405522-33405522
CGexonicDe novostopgainNM_006772c.C840Gp.Y280X34.0-Guo2018 T
Li2017 T
Stessman2017 T
Wang2016 T
SYNGAP1     217-14271-3940chr6:
33399974-33399975
CACexonicDe novoframeshift deletionNM_006772c.333delAp.P111fs--O’Roak2014 T
SYNGAP1     212-21043-1chr6:
33408610-33408611
TCTexonicDe novoframeshift deletionNM_006772c.1782delCp.F594fs--O’Roak2014 T
SYNGAP1     16chr6:
33402928-33402928
GAsplicingDe novosplicing16.05-O’Roak2014 T
SYNGAP1     G01-GEA-137-HIchr6:
33409384-33409384
GGCCexonicDe novoframeshift insertionNM_006772c.2142_2143insCCp.L714fs--Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
SYNGAP1     BO14/09chr6:
33410958-33410958
CCTexonicDe novoframeshift insertionNM_006772c.2630dupTp.L877fs--O’Roak2014 T
SYNGAP1     ER53899chr6:
33405933-33405935
TAATexonicDe novoframeshift deletionNM_006772c.1252_1253delp.K418fs--O’Roak2014 T
SYNGAP1     13073.p1chr6:
33408650-33408652
CTTCexonicDe novoframeshift deletionNM_006772c.1822_1823delp.F608fs--Dong2014 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Lowther2023 G
O’Roak2014 T
Satterstrom2020 E
Wilfert2021 G
Willsey2013 E
Zhou2022 GE
SYNGAP1     Mahjani2021:37chr6:
33411123-33411123
TCexonicnonsynonymous SNVNM_006772c.T2794Cp.F932L21.4-Mahjani2021 E
SYNGAP1     14277.p1chr6:
33410913-33410913
AAACCTGGTTAGTGTGTTGGTTAGTAGGCCTAGTATGAGGAGCGTTATGGAGTGGAAGTGAAATCACATGGCTexonicDe novostopgainNM_006772c.2584_2585insACCTGGTTAGTGTGTTGGTTAGTAGGCCTAGTATGAGGAGCGTTATGGAGTGGAAGTGAAATCACATGGCTp.N862_L863delinsNLVSVLVSRPSMRSVMEWKX--Satterstrom2020 E
SYNGAP1     08C74220chr6:
33399974-33399975
CACexonicDe novoframeshift deletionNM_006772c.333delAp.P111fs--Fu2022 E
SYNGAP1     SSC06095chr6:
33403326-33403326
GAexonicnonsynonymous SNVNM_006772c.G698Ap.C233Y23.4-Antaki2022 GE
SYNGAP1     12804_p1chr6:
33403326-33403326
GAexonicDe novononsynonymous SNVNM_006772c.G698Ap.C233Y23.4-Fu2022 E
SYNGAP1     SP0084433chr6:
33403302-33403302
CGexonicDe novostopgainNM_006772c.C674Gp.S225X37.0-Antaki2022 GE
Fu2022 E
Trost2022 G
Zhou2022 GE
SYNGAP1     F10841-1chr6:
33408690-33408690
CTexonicDe novostopgainNM_006772c.C1861Tp.R621X39.0-Fu2022 E
SYNGAP1     Ishay2021:33chr6:
33408600-33408600
GAexonicInheritednonsynonymous SNVNM_006772c.G1771Ap.A591T22.6-Ishay2021 E
SYNGAP1     Ishay2021:35chr6:
33408600-33408600
GAexonicInheritednonsynonymous SNVNM_006772c.G1771Ap.A591T22.6-Ishay2021 E
SYNGAP1     Ishay2021:34chr6:
33408600-33408600
GAexonicInheritednonsynonymous SNVNM_006772c.G1771Ap.A591T22.6-Ishay2021 E
SYNGAP1     SP0005275chr6:
33412306-33412306
CTexonicDe novononsynonymous SNVNM_006772c.C3494Tp.S1165L21.6-Antaki2022 GE
Fu2022 E
Trost2022 G
Zhou2022 GE
SYNGAP1     SSC04046chr6:
33411699-33411699
GTexonicstopgainNM_006772c.G3370Tp.G1124X41.0-Antaki2022 GE
SYNGAP1     SP0038495chr6:
33419606-33419606
GGCCCCCCCCCCCCCCCCCCCCCCCCCexonicDe novoframeshift insertionNM_006772c.3955_3956insCCCCCCCCCCCCCCCCCCCCCCCCCp.A1319fs--Fu2022 E
SYNGAP1     SP0005693chr6:
33419606-33419606
GGCCCCCCCCCCCCCCCCCCCCCCexonicDe novoframeshift insertionNM_006772c.3955_3956insCCCCCCCCCCCCCCCCCCCCCCp.A1319fs--Fu2022 E
SYNGAP1     SP0080242chr6:
33408546-33408546
CTexonicDe novononsynonymous SNVNM_006772c.C1717Tp.R573W17.32-Antaki2022 GE
Fu2022 E
Trost2022 G
Zhou2022 GE
SYNGAP1     SP0025466chr6:
33405712-33405712
GAexonicDe novononsynonymous SNVNM_006772c.G1030Ap.G344S22.1-Antaki2022 GE
Fu2022 E
Trost2022 G
Zhou2022 GE
SYNGAP1     11254_p1chr6:
33400029-33400029
GAexonicDe novosynonymous SNVNM_006772c.G387Ap.S129S--Fu2022 E
SYNGAP1     MAC1188chr6:
33411093-33411093
CTexonicDe novostopgainNM_006772c.C2764Tp.R922X39.0-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
SYNGAP1     SP0037844chr6:
33410949-33410949
CTexonicDe novostopgainNM_006772c.C2620Tp.Q874X40.0-Antaki2022 GE
Fu2022 E
Trost2022 G
Zhou2022 GE
SYNGAP1     SSC06347chr6:
33408650-33408652
CTTCexonicDe novoframeshift deletionNM_006772c.1822_1823delp.F608fs--Antaki2022 GE
Fu2022 E
Trost2022 G
SYNGAP1     Codina-Sola2015:ASD_3chr6:
33391308-33391308
GAexonicMaternalnonsynonymous SNVNM_006772c.G122Ap.R41H16.778.236E-6Codina-Sola2015 E
SYNGAP1     SP0050807chr6:
33414343-33414343
GAintronicDe novo--Fu2022 E
Trost2022 G
SYNGAP1     GX0516.p1chr6:
33410757-33410757
CTexonicPaternalnonsynonymous SNVNM_006772c.C2428Tp.R810C20.5-Guo2018 T
SYNGAP1     SP0015357chr6:
33393573-33393573
AGsplicingDe novosplicing15.68-Fu2022 E
Trost2022 G
Zhou2022 GE
SYNGAP1     SP0036848chr6:
33419606-33419606
GGGCCCCCCCexonicDe novoframeshift insertionNM_006772c.3955_3956insGCCCCCCCp.A1319fs--Fu2022 E
SYNGAP1     SP0052624chr6:
33408577-33408580
ACATAexonicDe novononframeshift deletionNM_006772c.1749_1751delp.583_584del--Fu2022 E
Trost2022 G
Zhou2022 GE
SYNGAP1     SP0144158chr6:
33419657-33419657
GAexonicDe novononsynonymous SNVNM_006772c.G4006Ap.E1336K15.0-Fu2022 E
Zhou2022 GE
SYNGAP1     M19759 Complex Event; expand row to view variants  Unknownframeshift substitution, frameshift deletionNM_006772
NM_006772
c.3545delA
c.3544_3545T
p.E1182fs
N/A
--Guo2018 T
Wang2016 T
SYNGAP1     M16067chr6:
33411159-33411159
GAexonicPaternalnonsynonymous SNVNM_006772c.G2830Ap.G944S12.148.293E-6Guo2018 T
Wang2016 T
SYNGAP1     118_15mrchr6:
33410665-33410665
GAsplicingDe novosplicing17.02-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
SYNGAP1     Chen2021:71chr6:
33400564-33400564
CTexonicDe novostopgainNM_006772c.C490Tp.R164X34.0-Chen2021 GET
SYNGAP1     EGAN00001101065chr6:
33400493-33400493
CTexonicDe novononsynonymous SNVNM_006772c.C419Tp.S140F20.9-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
SYNGAP1     Chen2021:70chr6:
33405509-33405510
CCCexonicDe novoframeshift deletionNM_006772c.828delCp.P276fs--Chen2021 GET
SYNGAP1     Wang2023:466chr6:
33411228-33411228
CTexonicDe novostopgainNM_006772c.C2899Tp.R967X40.0-Wang2023 E
SYNGAP1     SP0006795chr6:
33408918-33408918
AGintronicDe novo-7.0E-4Trost2022 G
SYNGAP1     Miyake2023:7544chr6:
33409439-33409439
CTexonicDe novostopgainNM_006772c.C2197Tp.Q733X40.0-Miyake2023 E
SYNGAP1     NDAR_INVRT684RNC_wes1chr6:
33410717-33410717
ACexonicDe novosynonymous SNVNM_006772c.A2388Cp.P796P-2.503E-5Lim2017 E
SYNGAP1     AU138Achr6:
33391326-33391326
GAexonicDe novononsynonymous SNVNM_006772c.G140Ap.R47Q15.24-DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
SYNGAP1     NDAR_INVDU502HMU_wes1chr6:
33405763-33405763
CTexonicDe novostopgainNM_006772c.C1081Tp.Q361X37.0-DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
SYNGAP1     JASD_Fam0063chr6:
33409439-33409439
CTexonicDe novostopgainNM_006772c.C2197Tp.Q733X40.0-Takata2018 E
SYNGAP1     09C80386chr6:
33408610-33408611
TCTexonicDe novoframeshift deletionNM_006772c.1782delCp.F594fs--DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
SYNGAP1     AU087Achr6:
33411228-33411228
CTexonicDe novostopgainNM_006772c.C2899Tp.R967X40.0-DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
SYNGAP1     NDAR_INVZX362NCN_wes1chr6:
33414451-33414455
GAACAGexonicDe novoframeshift deletionNM_006772c.3683_3686delp.E1228fs--DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
SYNGAP1     11254.p1chr6:
33400029-33400029
GAexonicDe novosynonymous SNVNM_006772c.G387Ap.S129S--Krumm2015 E
Satterstrom2020 E
Trost2022 G
SYNGAP1     SSC11011chr6:
33410913-33410913
AAACCTGGTTAGTGTGTTGGTTAGTAGGCCTAGTATGAGGAGCGTTATGGAGTGGAAGTGAAATCACATGGCTexonicDe novostopgainNM_006772c.2584_2585insACCTGGTTAGTGTGTTGGTTAGTAGGCCTAGTATGAGGAGCGTTATGGAGTGGAAGTGAAATCACATGGCTp.N862_L863delinsNLVSVLVSRPSMRSVMEWKX--Trost2022 G
SYNGAP1     3-0438-000chr6:
33406693-33406698
ACTGGTAexonicDe novononframeshift deletionNM_006772c.1674_1676delp.558_559del--Yuen2016 G
SYNGAP1     3-0438-000 Complex Event; expand row to view variants  De novoframeshift insertion, frameshift substitutionNM_006772
NM_006772
c.1667_1676TCTCACCA
c.1670_1671insA
N/A
p.S557fs
--Chan2022 G
Trost2022 G
Yuen2016 G
Zhou2022 GE
SYNGAP1     SP0234769chr6:
33403340-33403340
GTexonicstopgainNM_006772c.G712Tp.E238X38.0-Zhou2022 GE
SYNGAP1     SMHC01629s000chr6:
33399974-33399975
CACexonicDe novoframeshift deletionNM_006772c.333delAp.P111fs--Yuan2023 E
SYNGAP1     SP0248679chr6:
33400532-33400532
CAexonicnonsynonymous SNVNM_006772c.C458Ap.T153N9.279-Zhou2022 GE
SYNGAP1     11504.p1chr6:
33400029-33400029
GAexonicDe novosynonymous SNVNM_006772c.G387Ap.S129S--Iossifov2014 E
Kosmicki2017 E
SYNGAP1     SP0184840chr6:
33405559-33405560
CGCexonicDe novoframeshift deletionNM_006772c.878delGp.R293fs--Trost2022 G
Zhou2022 GE
SYNGAP1     12804.p1chr6:
33403326-33403326
GAexonicDe novononsynonymous SNVNM_006772c.G698Ap.C233Y23.4-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Lim2017 E
O’Roak2014 T
Satterstrom2020 E
Trost2022 G
Wilfert2021 G
Zhou2022 GE
SYNGAP1     12237.p1chr6:
33411673-33411673
TTTGGGGGCAGexonicDe novononframeshift insertionNM_006772c.3344_3345insTGGGGGCAGp.I1115delinsIGGS--Wilfert2021 G
Zhou2022 GE
SYNGAP1     14001.p1chr6:
33411384-33411384
CTexonicDe novononsynonymous SNVNM_006772c.C3055Tp.R1019C16.893.303E-5Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
SYNGAP1     Valentino2021:36chr6:
33410665-33410665
GAsplicingDe novosplicing17.02-Valentino2021 E
SYNGAP1     M20609chr6:
33411159-33411159
GAexonicMaternalnonsynonymous SNVNM_006772c.G2830Ap.G944S12.148.293E-6Guo2018 T
Wang2016 T
SYNGAP1     12237.p1chr6:
33411699-33411699
GTexonicDe novostopgainNM_006772c.G3370Tp.G1124X41.0-Wilfert2021 G
Zhou2022 GE
SYNGAP1     PN400330chr6:
33419613-33419615
CAGCexonicUnknownframeshift deletionNM_006772c.3963_3964delp.P1321fs-0.0037Leblond2019 E
SYNGAP1     GX0132.p1chr6:
33405577-33405577
CTexonicMaternalnonsynonymous SNVNM_006772c.C895Tp.R299C20.3-Guo2018 T
SYNGAP1     13804.p1chr6:
33388092-33388092
CTexonicsynonymous SNVNM_006772c.C51Tp.S17S--Zhou2022 GE
SYNGAP1     80001103406chr6:
33414425-33414427
ATGAexonicDe novoframeshift deletionNM_006772c.3657_3658delp.Y1219fs--Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
SYNGAP1     05C51696chr6:
33412317-33412317
GAexonicUnknownnonsynonymous SNVNM_006772c.G3505Ap.E1169K35.0-Stessman2017 T
SYNGAP1     GX0345.p1chr6:
33411594-33411594
GCexonicMaternalnonsynonymous SNVNM_006772c.G3265Cp.G1089R13.57-Guo2018 T
SYNGAP1     SP0093825chr6:
33408737-33408737
TCexonicsynonymous SNVNM_006772c.T1908Cp.F636F--Zhou2022 GE
SYNGAP1     GX0313.p1chr6:
33411159-33411159
GAexonicMaternalnonsynonymous SNVNM_006772c.G2830Ap.G944S12.148.293E-6Guo2018 T
SYNGAP1     JS0008.p1chr6:
33412222-33412222
AA/CexonicPaternal--Guo2018 T
SYNGAP1     11054.p1chr6:
33400029-33400029
GAexonicsynonymous SNVNM_006772c.G387Ap.S129S--Zhou2022 GE
SYNGAP1     Mahjani2021:129chr6:
33414425-33414427
ATGAexonicframeshift deletionNM_006772c.3657_3658delp.Y1219fs--Mahjani2021 E
SYNGAP1     SP0006454chr6:
33403084-33403084
TCsplicingDe novosplicing18.83-Feliciano2019 E
Fu2022 E
Trost2022 G
Zhou2022 GE
SYNGAP1     SP0124549chr6:
33414351-33414351
GAsplicingsplicing22.1-Zhou2022 GE
SYNGAP1     Lee2020:142chr6:
33405662-33405662
TCexonicnonsynonymous SNVNM_006772c.T980Cp.L327P20.4-Lee2020 T
SYNGAP1     A0238chr6:
33400564-33400564
CTexonicDe novostopgainNM_006772c.C490Tp.R164X34.0-Xiong2019 ET
SYNGAP1     5-0005-003chr6:
33411051-33411051
CTexonicDe novostopgainNM_006772c.C2722Tp.Q908X40.0-Trost2022 G
Zhou2022 GE
SYNGAP1     1-0552-003chr6:
33397577-33397590
CTGTGTGTGTGTGTCTGTGTGTGTGTintronicDe novo--Yuen2017 G
SYNGAP1     3-0661-000chr6:
33417987-33417987
CTintronicDe novo--Trost2022 G
Yuen2017 G
SYNGAP1     1-0408-003chr6:
33408465-33408465
TTTCintronicDe novo-2.0E-4Yuen2016 G
SYNGAP1     Stessman2017:ASD_1073-1chr6:
33408690-33408690
CTexonicInheritedstopgainNM_006772c.C1861Tp.R621X39.0-Stessman2017 T
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More