or
or
Exact

Results for "SHANK3"

Variant Events: 116

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SHANK3     217-14410-5190chr22:
51159850-51159850
AGexonicDe novononsynonymous SNVNM_033517c.A3547Gp.S1183G17.79-O’Roak2014 T
SHANK3     14470.p1chr22:
51159932-51159932
TTGexonicDe novoframeshift insertionNM_033517c.3630dupGp.L1210fs-6.0E-4Lowther2023 G
O’Roak2014 T
Zhou2022 GE
SHANK3     Zhang2023:ASD0148chr22:
51169309-51169322
GGGCTGGGGGCGGGGexonicDe novoframeshift deletionNM_033517c.4724_4736delp.G1575fs--Zhang2023 G
SHANK3     2-1644-004chr22:
51132965-51132965
GAintronicDe novo--Trost2022 G
Yuen2017 G
SHANK3     3-0107-000chr22:
51121806-51121808
CAGCexonicDe novoframeshift deletionNM_033517c.925_926delp.R309fs--Chan2022 G
Yuen2015 G
SHANK3     AU056603chr22:
51159722-51159722
GGGexonicDe novoframeshift insertionNM_033517c.3419dupGp.G1140fs--Zhou2019 T
SHANK3     Husson2020:296chr22:
51159068-51159069
CCCexonicframeshift deletionNM_033517c.2766delCp.A922fs--Husson2020 E
SHANK3     G01-GEA-133-HIchr22:
51160024-51160024
CGexonicDe novononsynonymous SNVNM_033517c.C3721Gp.R1241G8.009-Fu2022 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
SHANK3     AU035703chr22:
51159977-51159977
CCCexonicDe novoframeshift insertionNM_033517c.3674dupCp.P1225fs--Zhou2019 T
SHANK3     7902-01-002chr22:
51160837-51160839
GCCGexonicDe novoframeshift deletionNM_033517c.4535_4536delp.A1512fs--Satterstrom2020 E
Trost2022 G
Zhou2022 GE
SHANK3     Husson2020:353chr22:
51159715-51159715
GGGexonicframeshift insertionNM_033517c.3412dupGp.E1138fs--Husson2020 E
SHANK3     AU013503chr22:
51159977-51159977
CCCexonicUnknownframeshift insertionNM_033517c.3674dupCp.P1225fs--Zhou2019 T
SHANK3     Husson2020:377chr22:
51159390-51159391
TCTexonicframeshift deletionNM_033517c.3088delCp.L1030fs--Husson2020 E
SHANK3     10C110253chr22:
51137146-51137146
GAexonicDe novostopgainNM_033517c.G1485Ap.W495X38.0-DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
SHANK3     CC1093.201chr22:
51160013-51160026
TGCCCAGCCCCCGGTexonicDe novoframeshift deletionNM_033517c.3711_3723delp.L1237fs--Satterstrom2020 E
Trost2022 G
Zhou2022 GE
SHANK3     mAGRE2067chr22:
51143237-51143237
GAexonicDe novononsynonymous SNVNM_033517c.G1801Ap.V601M15.84-Cirnigliaro2023 G
SHANK3     mAGRE5690chr22:
51115077-51115078
CACexonicMaternalframeshift deletionNM_033517c.296delAp.Q99fs--Cirnigliaro2023 G
SHANK3     2-1184-003chr22:
51121926-51121926
CGintronicDe novo--Yuen2016 G
Yuen2017 G
SHANK3     mAGRE5689chr22:
51115077-51115078
CACexonicMaternalframeshift deletionNM_033517c.296delAp.Q99fs--Cirnigliaro2023 G
SHANK3     7-0123-003chr22:
51153476-51153476
GAsplicingDe novosplicing12.65-Trost2022 G
Yuen2017 G
Zhou2022 GE
SHANK3     SP0121621chr22:
51159932-51159932
TTGexonicDe novoframeshift insertionNM_033517c.3630dupGp.L1210fs-6.0E-4Fu2022 E
Trost2022 G
Zhou2022 GE
SHANK3     PN400285chr22:
51135697-51135697
TTGintronicUnknown-0.0098Leblond2019 E
SHANK3     SP0086069chr22:
51159932-51159932
TTGexonicDe novoframeshift insertionNM_033517c.3630dupGp.L1210fs-6.0E-4Fu2022 E
Trost2022 G
Zhou2022 GE
SHANK3     SP0082034chr22:
51158776-51158776
TTCGCCGCexonicDe novononframeshift insertionNM_033517c.2473_2474insCGCCGCp.S825delinsSPP--Fu2022 E
Zhou2022 GE
SHANK3     2-1195-003chr22:
51120928-51120928
TCintronicDe novo--Yuen2017 G
SHANK3     SP0074175chr22:
51117614-51117614
GTexonicDe novononsynonymous SNVNM_033517c.G768Tp.Q256H14.91-Fu2022 E
Zhou2022 GE
SHANK3     ASD-685chr22:
51159933-51159933
GGGexonicDe novoframeshift insertionNM_033517c.3630dupGp.L1210fs--Du2018 E
SHANK3     G01-GEA-71-HIchr22:
51159932-51159932
TTGexonicDe novoframeshift insertionNM_033517c.3630dupGp.L1210fs-6.0E-4Satterstrom2020 E
Trost2022 G
Zhou2022 GE
SHANK3     SP0064093chr22:
51135968-51135984
CTGTATTCGAATTCGAGCintronicDe novo--Fu2022 E
SHANK3     SP0011137chr22:
51137225-51137225
CTexonicDe novononsynonymous SNVNM_033517c.C1564Tp.R522W12.58-Fu2022 E
Zhou2022 GE
SHANK3     SP0038640chr22:
51153476-51153476
GAsplicingDe novosplicing12.65-Fu2022 E
Trost2022 G
Zhou2022 GE
SHANK3     SP0035986chr22:
51169673-51169673
TCexonicDe novononsynonymous SNVNM_033517c.T5087Cp.L1696P19.01-Fu2022 E
Zhou2022 GE
SHANK3     SP0073275chr22:
51169631-51169631
GAexonicDe novononsynonymous SNVNM_033517c.G5045Ap.G1682D23.1-Fu2022 E
Zhou2022 GE
SHANK3     F10024-1chr22:
51133516-51133516
TTGGGGGGGGGintronicDe novo--Satterstrom2020 E
Trost2022 G
SHANK3     CC1380_201chr22:
51117587-51117587
CTexonicDe novosynonymous SNVNM_033517c.C741Tp.D247D-2.925E-5Fu2022 E
SHANK3     SP0001367chr22:
51160866-51160866
GTsplicingDe novosplicing20.9-Feliciano2019 E
Fu2022 E
Trost2022 G
Zhou2022 GE
SHANK3     SP0051409chr22:
51159932-51159932
TTGexonicDe novoframeshift insertionNM_033517c.3630dupGp.L1210fs-6.0E-4Feliciano2019 E
Fu2022 E
Zhou2022 GE
SHANK3     Bruno2021:XIIIchr22:
51143244-51143249
GTGTGGGexonicDe novoframeshift deletionNM_033517c.1809_1813delp.G603fs--Bruno2021 E
SHANK3     F10310-1chr22:
51160325-51160327
CTGCexonicDe novoframeshift deletionNM_033517c.4023_4024delp.S1341fs--Fu2022 E
SHANK3     CC1093_201chr22:
51160013-51160026
TGCCCAGCCCCCGGTexonicDe novoframeshift deletionNM_033517c.3711_3723delp.L1237fs--Fu2022 E
SHANK3     GEA421chr22:
51159718-51159718
CTexonicDe novostopgainNM_033517c.C3415Tp.R1139X39.0-Fu2022 E
SHANK3     28_15auchr22:
51153476-51153476
GAsplicingDe novosplicing12.65-Fu2022 E
SHANK3     Valentino2021:32chr22:
51153476-51153476
GAsplicingDe novosplicing12.65-Valentino2021 E
SHANK3     161522chr22:
51159573-51159607
CAGCTCACCCCTGGCCCTTGCCCTGGCTGCCCGAGCexonicDe novoframeshift deletionNM_033517c.3271_3304delp.S1091fs--Fu2022 E
SHANK3     Wang2023:341chr22:
51160342-51160344
GACGexonicDe novoframeshift deletionNM_033517c.4040_4041delp.D1347fs--Wang2023 E
SHANK3     Valentino2021:31chr22:
51158931-51158931
CCGCexonicDe novoframeshift insertionNM_033517c.2628_2629insGCp.R876fs--Valentino2021 E
SHANK3     Hu2022:1chr22:
51159988-51159988
CTexonicDe novostopgainNM_033517c.C3685Tp.Q1229X36.0-Hu2022 T
SHANK3     5075_16MRchr22:
51159551-51159555
TCACCTexonicDe novoframeshift deletionNM_033517c.3249_3252delp.L1083fs--Fu2022 E
SHANK3     PN400144chr22:
51135697-51135697
TTGintronicUnknown-0.0098Leblond2019 E
SHANK3     ASC_NP275chr22:
51153338-51153338
TAintronicDe novo--Fu2022 E
SHANK3     GEA495chr22:
51159520-51159520
GCexonicDe novononsynonymous SNVNM_033517c.G3217Cp.G1073R7.513-Fu2022 E
SHANK3     Hu2022:7chr22:
51158732-51158732
CCCexonicDe novoframeshift insertionNM_033517c.2429dupCp.P810fs--Hu2022 T
SHANK3     SSC11265chr22:
51159932-51159932
TTGexonicframeshift insertionNM_033517c.3630dupGp.L1210fs-6.0E-4Antaki2022 GE
SHANK3     SP0012883chr22:
51160013-51160026
TGCCCAGCCCCCGGTexonicDe novoframeshift deletionNM_033517c.3711_3723delp.L1237fs--Antaki2022 GE
Fu2022 E
Zhou2022 GE
SHANK3     SP0037923chr22:
51160008-51160021
GCCCCTGCCCAGCCGexonicDe novoframeshift deletionNM_033517c.3706_3718delp.P1236fs--Antaki2022 GE
Fu2022 E
Zhou2022 GE
SHANK3     Hu2022:27chr22:
51159726-51159728
CCTCexonicUnknownframeshift deletionNM_033517c.3424_3425delp.L1142fs--Hu2022 T
SHANK3     MSSNG00426-003chr22:
51170223-51170223
CTUTR3De novo--Trost2022 G
SHANK3     2-1455-003 Complex Event; expand row to view variants  De novoframeshift insertionNM_033517
NM_033517
c.4491dupG
c.4495dupG
p.L1497fs
p.E1499fs
--Trost2022 G
Yuen2016 G
Yuen2017 G
Zhou2022 GE
SHANK3     PN400416chr22:
51135697-51135697
TTGintronicUnknown-0.0098Leblond2019 E
SHANK3     AU009805chr22:
51159131-51159132
AGAexonicDe novoframeshift deletionNM_033517c.2829delGp.Q943fs--Trost2022 G
Yuen2017 G
Zhou2022 GE
SHANK3     Wang2023:399chr22:
51159932-51159932
TTGexonicDe novoframeshift insertionNM_033517c.3630dupGp.L1210fs-6.0E-4Wang2023 E
SHANK3     SP0050021chr22:
51169720-51169731
AGGCAGCTGGACAexonicDe novoframeshift deletionNM_033517c.5135_5145delp.R1712fs--Antaki2022 GE
Fu2022 E
Zhou2022 GE
SHANK3     MT_88.3chr22:
51160126-51160126
CTexonicDe novostopgainNM_033517c.C3823Tp.Q1275X39.0-Antaki2022 GE
Trost2022 G
Zhou2022 GE
SHANK3     F5252-1chr22:
51160012-51160025
CTGCCCAGCCCCCGCexonicDe novoframeshift deletionNM_033517c.3710_3722delp.L1237fs--Montenegro2019 E
SHANK3     SP0351536chr22:
51153434-51153436
CAGCexonicframeshift deletionNM_033517c.2183_2184delp.Q728fs--Zhou2022 GE
SHANK3     SP0129695chr22:
51123060-51123062
CCACexonicframeshift deletionNM_033517c.1012_1013delp.H338fs--Zhou2022 GE
SHANK3     SP0263694chr22:
51158756-51158756
CTexonicnonsynonymous SNVNM_033517c.C2453Tp.S818L20.9-Zhou2022 GE
SHANK3     SP0192192chr22:
51158755-51158756
TCTexonicDe novoframeshift deletionNM_033517c.2453delCp.S818fs--Trost2022 G
Zhou2022 GE
SHANK3     SP0220974chr22:
51169184-51169184
CTexonicnonsynonymous SNVNM_033517c.C4598Tp.S1533L16.02-Zhou2022 GE
SHANK3     SP0345333chr22:
51160466-51160468
GACGexonicframeshift deletionNM_033517c.4164_4165delp.G1388fs--Zhou2022 GE
SHANK3     iHART2067chr22:
51143237-51143237
GAexonicDe novononsynonymous SNVNM_033517c.G1801Ap.V601M15.84-Ruzzo2019 G
SHANK3     SP0255430chr22:
51169383-51169385
CCTCexonicframeshift deletionNM_033517c.4798_4799delp.L1600fs--Zhou2022 GE
SHANK3     SP0348835chr22:
51159932-51159932
TTGexonicframeshift insertionNM_033517c.3630dupGp.L1210fs-6.0E-4Zhou2022 GE
SHANK3     Schaaf2011:39chr22:
51143462-51143462
GAexonicUnknownnonsynonymous SNVNM_033517c.G1925Ap.R642H11.743.318E-5Schaaf2011 T
SHANK3     SP0224524chr22:
51159684-51159686
CCTCexonicDe novoframeshift deletionNM_033517c.3382_3383delp.L1128fs--Trost2022 G
Zhou2022 GE
SHANK3     SP0149317chr22:
51160342-51160344
GACGexonicDe novoframeshift deletionNM_033517c.4040_4041delp.D1347fs--Trost2022 G
Zhou2022 GE
SHANK3     SP0037406chr22:
51159932-51159932
TTGexonicframeshift insertionNM_033517c.3630dupGp.L1210fs-6.0E-4Zhou2022 GE
SHANK3     Schaaf2011:42chr22:
51160154-51160154
GAexonicUnknownnonsynonymous SNVNM_033517c.G3851Ap.R1284K13.68.0E-4Schaaf2011 T
SHANK3     Schaaf2011:43chr22:
51160231-51160231
GAexonicUnknownnonsynonymous SNVNM_033517c.G3928Ap.A1310T0.2181.0E-4Schaaf2011 T
SHANK3     Schaaf2011:40chr22:
51159884-51159884
GAexonicUnknownnonsynonymous SNVNM_033517c.G3581Ap.G1194D18.77-Schaaf2011 T
SHANK3     Schaaf2011:41chr22:
51160018-51160018
ATexonicUnknownnonsynonymous SNVNM_033517c.A3715Tp.S1239C10.13-Schaaf2011 T
SHANK3     Schaaf2011:46chr22:
51160493-51160493
CTexonicUnknownnonsynonymous SNVNM_033517c.C4190Tp.P1397L20.9-Schaaf2011 T
SHANK3     Schaaf2011:47chr22:
51160540-51160540
GAexonicUnknownnonsynonymous SNVNM_033517c.G4237Ap.V1413M19.4-Schaaf2011 T
SHANK3     Schaaf2011:44chr22:
51160259-51160259
TGexonicUnknownnonsynonymous SNVNM_033517c.T3956Gp.V1319G4.6418.0E-4Schaaf2011 T
SHANK3     Schaaf2011:45chr22:
51160394-51160394
CTexonicUnknownnonsynonymous SNVNM_033517c.C4091Tp.T1364M19.53-Schaaf2011 T
SHANK3     Schaaf2011:50chr22:
51169259-51169259
CTexonicUnknownnonsynonymous SNVNM_033517c.C4673Tp.A1558V12.15-Schaaf2011 T
SHANK3     Schaaf2011:51chr22:
51169364-51169364
CTexonicUnknownnonsynonymous SNVNM_033517c.C4778Tp.T1593I14.6-Schaaf2011 T
SHANK3     Schaaf2011:48chr22:
51169207-51169207
CTexonicUnknownnonsynonymous SNVNM_033517c.C4621Tp.P1541S15.68-Schaaf2011 T
SHANK3     Schaaf2011:49chr22:
51169241-51169241
GTexonicUnknownnonsynonymous SNVNM_033517c.G4655Tp.S1552I16.49-Schaaf2011 T
SHANK3     Schaaf2011:54chr22:
51169463-51169463
CTexonicUnknownnonsynonymous SNVNM_033517c.C4877Tp.S1626L9.874-Schaaf2011 T
SHANK3     AU3122301chr22:
51134816-51134816
TCintronicDe novo--Yuen2017 G
SHANK3     Schaaf2011:55chr22:
51169480-51169480
GAexonicUnknownnonsynonymous SNVNM_033517c.G4894Ap.A1632T0.763-Schaaf2011 T
SHANK3     Schaaf2011:52chr22:
51169442-51169442
GAexonicUnknownnonsynonymous SNVNM_033517c.G4856Ap.R1619H13.87-Schaaf2011 T
SHANK3     Hu2022:65chr22:
51169394-51169394
CTexonicUnknownnonsynonymous SNVNM_033517c.C4808Tp.P1603L15.11-Hu2022 T
SHANK3     Schaaf2011:53chr22:
51169459-51169459
CTexonicUnknownnonsynonymous SNVNM_033517c.C4873Tp.P1625S12.58-Schaaf2011 T
SHANK3     Schaaf2011:58chr22:
51169508-51169508
GAexonicUnknownnonsynonymous SNVNM_033517c.G4922Ap.G1641D16.35-Schaaf2011 T
SHANK3     Schaaf2011:56chr22:
51169499-51169499
GAexonicUnknownnonsynonymous SNVNM_033517c.G4913Ap.G1638D10.65-Schaaf2011 T
SHANK3     Schaaf2011:57chr22:
51169504-51169504
CAexonicUnknownnonsynonymous SNVNM_033517c.C4918Ap.P1640T14.470.0013Schaaf2011 T
SHANK3     80001101154chr22:
51143435-51143435
TGexonicDe novononsynonymous SNVNM_033517c.T1898Gp.V633G22.8-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
SHANK3     Hu2022:75chr22:
51142293-51142293
CTexonicUnknownnonsynonymous SNVNM_033517c.C1576Tp.R526W15.211.92E-5Hu2022 T
SHANK3     AU3154301 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
SHANK3     08C72791chr22:
51169147-51169147
AGsplicingDe novosplicing21.0-Satterstrom2020 E
Trost2022 G
Zhou2022 GE
SHANK3     20-0421654-08chr22:
51117094-51117094
CGexonicDe novononsynonymous SNVNM_033517c.C421Gp.P141A23.7-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
SHANK3     Mahjani2021:100chr22:
51137191-51137191
CAexonicstopgainNM_033517c.C1530Ap.C510X37.0-Mahjani2021 E
SHANK3     1-0007-003chr22:
51121844-51121844
AGexonicDe novononsynonymous SNVNM_033517c.A962Gp.Q321R24.5-Yuen2017 G
Zhou2022 GE
SHANK3     SP0074175chr22:
51117594-51117594
GTexonicnonsynonymous SNVNM_033517c.G748Tp.G250C24.7-Zhou2022 GE
SHANK3     SP0007340chr22:
51117561-51117561
GCexonicnonsynonymous SNVNM_033517c.G715Cp.D239H19.15-Zhou2022 GE
SHANK3     PN400128chr22:
51135697-51135697
TTGintronicUnknown-0.0098Leblond2019 E
SHANK3     F10163-1chr22:
51117840-51117840
GAexonicDe novononsynonymous SNVNM_033517c.G869Ap.C290Y21.3-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
SHANK3     2-1774-003chr22:
51159932-51159932
TTGexonicDe novoframeshift insertionNM_033517c.3630dupGp.L1210fs-6.0E-4Trost2022 G
Zhou2022 GE
SHANK3     1-1047-003chr22:
51159932-51159932
TTGexonicDe novoframeshift insertionNM_033517c.3630dupGp.L1210fs-6.0E-4Trost2022 G
Zhou2022 GE
SHANK3     PN400396chr22:
51135697-51135697
TTGintronicUnknown-0.0098Leblond2019 E
SHANK3     SP0081919chr22:
51160024-51160024
CCGexonicframeshift insertionNM_033517c.3722dupGp.R1241fs--Zhou2022 GE
SHANK3     09C89168chr22:
51159850-51159850
AGexonicDe novononsynonymous SNVNM_033517c.A3547Gp.S1183G17.79-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
SHANK3     7-0141-003chr22:
51117976-51117976
CCAGGintronicDe novo--Yuen2017 G
SHANK3     PN400495chr22:
51135697-51135697
TTGintronicUnknown-0.0098Leblond2019 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More