or
or
Exact

Results for "TYRO3"

Variant Events: 46

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
TYRO3     2-1277-003chr15:
41949081-41949081
TTCTCTCACTTCAGCCTCCintergenicDe novo--Yuen2017 G
TYRO3     PN400115chr15:
41862897-41862897
GGGAGAexonicUnknownframeshift insertionNM_006293c.1579_1580insGAGAp.G527fs-0.001Leblond2019 E
TYRO3     PN400349chr15:
41862897-41862897
GGGAGAexonicUnknownframeshift insertionNM_006293c.1579_1580insGAGAp.G527fs-0.001Leblond2019 E
TYRO3     1-0296-003chr15:
41898554-41898554
CGintergenicDe novo--Yuen2017 G
TYRO3     PN400124chr15:
41863884-41863884
TTGGexonicUnknownframeshift insertionNM_006293c.1752_1753insGGp.V584fs-4.127E-5Leblond2019 E
TYRO3     PN400103chr15:
41862897-41862897
GGGAGAexonicUnknownframeshift insertionNM_006293c.1579_1580insGAGAp.G527fs-0.001Leblond2019 E
TYRO3     1-0972-003chr15:
41895180-41895180
TCintergenicDe novo--Yuen2017 G
TYRO3     PN400157chr15:
41862897-41862897
GGGAGAexonicUnknownframeshift insertionNM_006293c.1579_1580insGAGAp.G527fs-0.001Leblond2019 E
TYRO3     PN400100chr15:
41862897-41862897
GGGAGAexonicUnknownframeshift insertionNM_006293c.1579_1580insGAGAp.G527fs-0.001Leblond2019 E
TYRO3     PN400261chr15:
41865665-41865665
GGTGGGCGTTCGGGGTGACCATexonicUnknownframeshift insertionNM_006293c.2145_2146insTGGGCGTTCGGGGTGACCATp.V715fs-4.0E-4Leblond2019 E
TYRO3     PN400261chr15:
41862897-41862897
GGGAGAexonicUnknownframeshift insertionNM_006293c.1579_1580insGAGAp.G527fs-0.001Leblond2019 E
TYRO3     PN400416chr15:
41863884-41863884
TTGGexonicUnknownframeshift insertionNM_006293c.1752_1753insGGp.V584fs-4.127E-5Leblond2019 E
TYRO3     PN400219chr15:
41862897-41862897
GGGAGAexonicUnknownframeshift insertionNM_006293c.1579_1580insGAGAp.G527fs-0.001Leblond2019 E
TYRO3     PN400518chr15:
41862897-41862897
GGGAGAexonicUnknownframeshift insertionNM_006293c.1579_1580insGAGAp.G527fs-0.001Leblond2019 E
TYRO3     1360JS0006chr15:
41853769-41853769
GAexonicDe novononsynonymous SNVNM_006293c.G341Ap.R114Q9.781-DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Satterstrom2020 E
TYRO3     PN400455chr15:
41863884-41863884
TTGGexonicUnknownframeshift insertionNM_006293c.1752_1753insGGp.V584fs-4.127E-5Leblond2019 E
TYRO3     PN400386chr15:
41862897-41862897
GGGAGAexonicUnknownframeshift insertionNM_006293c.1579_1580insGAGAp.G527fs-0.001Leblond2019 E
TYRO3     PN400455chr15:
41862897-41862897
GGGAGAexonicUnknownframeshift insertionNM_006293c.1579_1580insGAGAp.G527fs-0.001Leblond2019 E
TYRO3     PN400501chr15:
41865665-41865665
GGTGGGCGTTCGGGGTGACCATexonicUnknownframeshift insertionNM_006293c.2145_2146insTGGGCGTTCGGGGTGACCATp.V715fs-4.0E-4Leblond2019 E
TYRO3     PN400343chr15:
41862897-41862897
GGGAGAexonicUnknownframeshift insertionNM_006293c.1579_1580insGAGAp.G527fs-0.001Leblond2019 E
TYRO3     PN400562chr15:
41862897-41862897
GGGAGAexonicUnknownframeshift insertionNM_006293c.1579_1580insGAGAp.G527fs-0.001Leblond2019 E
TYRO3     Bruno2021:XIVchr15:
41862356-41862356
TCsplicingDe novosplicing21.7-Bruno2021 E
TYRO3     PN400343chr15:
41863884-41863884
TTGGexonicUnknownframeshift insertionNM_006293c.1752_1753insGGp.V584fs-4.127E-5Leblond2019 E
TYRO3     PN400127chr15:
41862897-41862897
GGGAGAexonicUnknownframeshift insertionNM_006293c.1579_1580insGAGAp.G527fs-0.001Leblond2019 E
TYRO3     PN400393chr15:
41865665-41865665
GGTGGGCGTTCGGGGTGACCATexonicUnknownframeshift insertionNM_006293c.2145_2146insTGGGCGTTCGGGGTGACCATp.V715fs-4.0E-4Leblond2019 E
TYRO3     PN400305chr15:
41863884-41863884
TTGGexonicUnknownframeshift insertionNM_006293c.1752_1753insGGp.V584fs-4.127E-5Leblond2019 E
TYRO3     Bruno2021:XIVchr15:
41861222-41861222
TAsplicingDe novosplicing20.6-Bruno2021 E
TYRO3     PN400253chr15:
41862897-41862897
GGGAGAexonicUnknownframeshift insertionNM_006293c.1579_1580insGAGAp.G527fs-0.001Leblond2019 E
TYRO3     PN400273chr15:
41862897-41862897
GGGAGAexonicUnknownframeshift insertionNM_006293c.1579_1580insGAGAp.G527fs-0.001Leblond2019 E
TYRO3     PN400283chr15:
41863884-41863884
TTGGexonicUnknownframeshift insertionNM_006293c.1752_1753insGGp.V584fs-4.127E-5Leblond2019 E
TYRO3     PN400528chr15:
41863884-41863884
TTGGexonicUnknownframeshift insertionNM_006293c.1752_1753insGGp.V584fs-4.127E-5Leblond2019 E
TYRO3     PN400260chr15:
41865665-41865665
GGTGGGCGTTCGGGGTGACCATexonicUnknownframeshift insertionNM_006293c.2145_2146insTGGGCGTTCGGGGTGACCATp.V715fs-4.0E-4Leblond2019 E
TYRO3     PN400116chr15:
41862897-41862897
GGGAGAexonicUnknownframeshift insertionNM_006293c.1579_1580insGAGAp.G527fs-0.001Leblond2019 E
TYRO3     PN400306chr15:
41862897-41862897
GGGAGAexonicUnknownframeshift insertionNM_006293c.1579_1580insGAGAp.G527fs-0.001Leblond2019 E
TYRO3     PN400133chr15:
41862897-41862897
GGGAGAexonicUnknownframeshift insertionNM_006293c.1579_1580insGAGAp.G527fs-0.001Leblond2019 E
TYRO3     PN400385chr15:
41863884-41863884
TTGGexonicUnknownframeshift insertionNM_006293c.1752_1753insGGp.V584fs-4.127E-5Leblond2019 E
TYRO3     PN400439chr15:
41863884-41863884
TTGGexonicUnknownframeshift insertionNM_006293c.1752_1753insGGp.V584fs-4.127E-5Leblond2019 E
TYRO3     PN400129chr15:
41862897-41862897
GGGAGAexonicUnknownframeshift insertionNM_006293c.1579_1580insGAGAp.G527fs-0.001Leblond2019 E
TYRO3     PN400306chr15:
41863884-41863884
TTGGexonicUnknownframeshift insertionNM_006293c.1752_1753insGGp.V584fs-4.127E-5Leblond2019 E
TYRO3     PN400507chr15:
41862897-41862897
GGGAGAexonicUnknownframeshift insertionNM_006293c.1579_1580insGAGAp.G527fs-0.001Leblond2019 E
TYRO3     PN400431chr15:
41862897-41862897
GGGAGAexonicUnknownframeshift insertionNM_006293c.1579_1580insGAGAp.G527fs-0.001Leblond2019 E
TYRO3     PN400118chr15:
41863884-41863884
TTGGexonicUnknownframeshift insertionNM_006293c.1752_1753insGGp.V584fs-4.127E-5Leblond2019 E
TYRO3     1-0935-003chr15:
41883479-41883479
CAintergenicDe novo--Yuen2017 G
TYRO3     PN400560chr15:
41862897-41862897
GGGAGAexonicUnknownframeshift insertionNM_006293c.1579_1580insGAGAp.G527fs-0.001Leblond2019 E
TYRO3     SP0052491chr15:
41861116-41861116
GTexonicDe novononsynonymous SNVNM_006293c.G1148Tp.G383V10.68-Fu2022 E
TYRO3     PN400488chr15:
41862897-41862897
GGGAGAexonicUnknownframeshift insertionNM_006293c.1579_1580insGAGAp.G527fs-0.001Leblond2019 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More