or
or
Exact

Results for "NLGN4X"

Variant Events: 20

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
NLGN4X     2-1300-003chrX:
6235578-6235578
CTintergenicDe novo--Yuen2017 G
NLGN4X     1-0269-005chrX:
5944823-5944823
CTintronicDe novo--Yuen2017 G
NLGN4X     3-0456-000BchrX:
5897762-5897792
TATATGTGTGTATATATACACACATACATATTATATintronicDe novo--Yuen2017 G
NLGN4X     1-0303-003chrX:
5835004-5835004
GAintronicDe novo--Yuen2017 G
NLGN4X     2-0109-003chrX:
5980275-5980275
CTintronicDe novo--Yuen2017 G
NLGN4X     5-0088-003chrX:
6286309-6286309
TAintergenicDe novo--Yuen2017 G
NLGN4X     211-5274-3chrX:
5821899-5821899
GAexonicMaternalstopgainNM_001282146
NM_020742
NM_181332
NM_001282145
c.C820T
c.C820T
c.C820T
c.C820T
p.Q274X
p.Q274X
p.Q274X
p.Q274X
44.0-Stessman2017 T
NLGN4X     2-1507-003chrX:
6163214-6163237
TGTGTGTGTGTGCGTGTGTGTGTGTGTGTGTGTGTGintergenicDe novo--Yuen2017 G
NLGN4X     AU3517301chrX:
6263882-6263882
GAintergenicDe novo--Yuen2017 G
NLGN4X     7-0192-003chrX:
6032353-6032353
TAintronicDe novo--Yuen2017 G
NLGN4X     AU4069301chrX:
5907211-5907216
TTGTGTTTGTintronicDe novo--Yuen2017 G
NLGN4X     2-1264-003chrX:
6258087-6258087
TCintergenicDe novo--Yuen2017 G
NLGN4X     AU006804chrX:
5995481-5995481
CAintronicDe novo--Yuen2017 G
NLGN4X     1-0433-003chrX:
6013405-6013405
GCintronicDe novo--Yuen2017 G
NLGN4X     AU-5700chrX:
5821734-5821734
GAexonicInheritedstopgainNM_001282146
NM_020742
NM_181332
NM_001282145
c.C985T
c.C985T
c.C985T
c.C985T
p.Q329X
p.Q329X
p.Q329X
p.Q329X
44.0-Yu2013 E
NLGN4X     AU-13400chrX:
5811012-5811012
CTexonicInheritednonsynonymous SNVNM_001282146
NM_020742
NM_181332
NM_001282145
c.G2297A
c.G2297A
c.G2297A
c.G2297A
p.R766Q
p.R766Q
p.R766Q
p.R766Q
18.08-Yu2013 E
NLGN4X     04C37153chrX:
5827153-5827154
AAAexonicUnknownframeshift deletionNM_001282146
NM_020742
NM_181332
NM_001282145
c.752delT
c.752delT
c.752delT
c.752delT
p.F251fs
p.F251fs
p.F251fs
p.F251fs
--Stessman2017 T
NLGN4X     04C37154chrX:
5827153-5827154
AAAexonicUnknownframeshift deletionNM_001282146
NM_020742
NM_181332
NM_001282145
c.752delT
c.752delT
c.752delT
c.752delT
p.F251fs
p.F251fs
p.F251fs
p.F251fs
--Stessman2017 T
NLGN4X     AU2495302chrX:
6278161-6278161
GCintergenicDe novo--Yuen2017 G
NLGN4X     5-0033-004chrX:
5927987-5927987
AGintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More