or
or
Exact

Results for "ANK3"

Variant Events: 69

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ANK3     A6chr10:
61949919-61949919
GAintronicDe novo--Wu2018 G
ANK3     7-0024-005chr10:
61996330-61996330
CTintronicDe novo--Yuen2017 G
ANK3     AU2117302chr10:
62027323-62027323
TGintronicDe novo--Yuen2017 G
ANK3     M08118chr10:
61965608-61965608
CTexonicPaternalnonsynonymous SNVNM_001204404
NM_020987
NM_001204403
c.G1184A
c.G1235A
c.G1217A
p.R395Q
p.R412Q
p.R406Q
34.0-Guo2018 T
Wang2016 T
ANK3     AU0636303chr10:
62307649-62307649
AGintronicDe novo--Yuen2017 G
ANK3     212-21052-1chr10:
61926617-61926617
GAexonicUnknownnonsynonymous SNVNM_001204404
NM_020987
NM_001204403
c.C2465T
c.C2516T
c.C2498T
p.T822M
p.T839M
p.T833M
21.05.782E-5Stessman2017 T
ANK3     AU3702307chr10:
61983852-61983852
TCintronicDe novo--Yuen2017 G
ANK3     AU2793302chr10:
62373775-62373775
TGintronicDe novo--Yuen2017 G
ANK3     D2P3Nchr10:
61868693-61868693
CAexonicUnknownnonsynonymous SNVNM_001149
NM_020987
NM_001204403
NM_001204404
c.G470T
c.G3068T
c.G3050T
c.G3071T
p.R157L
p.R1023L
p.R1017L
p.R1024L
28.7-Stessman2017 T
ANK3     AU4056301chr10:
62021744-62021744
TCintronicDe novo-8.743E-6Yuen2017 G
ANK3     3-0448-000chr10:
62448998-62448998
CAintronicDe novo--Yuen2016 G
Yuen2017 G
ANK3     AU2035302chr10:
61797747-61797747
GCintronicDe novo--Yuen2017 G
ANK3     AU2035302chr10:
61801749-61801749
ACintronicDe novo--Yuen2017 G
ANK3     2-1251-003chr10:
62258731-62258731
CTintronicDe novo--Yuen2017 G
ANK3     2-0116-005chr10:
62057498-62057498
ATintronicDe novo--Yuen2017 G
ANK3     03C15852chr10:
61932674-61932674
GAexonicInheritednonsynonymous SNVNM_001204404
NM_020987
NM_001204403
c.C2315T
c.C2366T
c.C2348T
p.P772L
p.P789L
p.P783L
32.08.282E-6Stessman2017 T
ANK3     09C83751chr10:
61932806-61932806
AGintronicDe novo--Kosmicki2017 E
Satterstrom2020 E
ANK3     Shi2013:1chr10:
61829571-61829571
CTexonicInheritednonsynonymous SNVNM_020987c.G11068Ap.G3690R12.53-Shi2013 G
ANK3     M19816chr10:
61846521-61846521
GAexonicPaternalnonsynonymous SNVNM_001149
NM_020987
NM_001204403
NM_001204404
c.C1064T
c.C3662T
c.C3644T
c.C3665T
p.P355L
p.P1221L
p.P1215L
p.P1222L
34.0-Guo2018 T
Stessman2017 T
Wang2016 T
ANK3     AU2035301chr10:
61797747-61797747
GCintronicDe novo--Yuen2017 G
ANK3     J2Y7Xchr10:
61846455-61846455
CTexonicInheritednonsynonymous SNVNM_001149
NM_020987
NM_001204403
NM_001204404
c.G1130A
c.G3728A
c.G3710A
c.G3731A
p.R377H
p.R1243H
p.R1237H
p.R1244H
35.08.256E-6Stessman2017 T
ANK3     1-0196-005chr10:
62395255-62395255
TAintronicDe novo--Yuen2017 G
ANK3     2-0223-004chr10:
62144730-62144751
GCCTGGATCCCCATCAGAGCTTGintronicDe novo--Yuen2017 G
ANK3     AU2035301chr10:
61801749-61801749
ACintronicDe novo--Yuen2017 G
ANK3     2-0273-003chr10:
61888350-61888350
GTintronicDe novo--Yuen2017 G
ANK3     M13309chr10:
61932868-61932868
GAexonicPaternalnonsynonymous SNVNM_001204404
NM_020987
NM_001204403
c.C2210T
c.C2261T
c.C2243T
p.A737V
p.A754V
p.A748V
36.09.906E-5Wang2016 T
ANK3     1-0252-003chr10:
61985014-61985014
TCintronicDe novo--Yuen2017 G
ANK3     AU3907302chr10:
62449780-62449780
CTintronicDe novo--Yuen2017 G
ANK3     M31974chr10:
61959930-61959930
CTexonicUnknownnonsynonymous SNVNM_001204404
NM_020987
NM_001204403
c.G1397A
c.G1448A
c.G1430A
p.R466Q
p.R483Q
p.R477Q
35.0-Guo2018 T
ANK3     Q7E4Fchr10:
61959930-61959930
CTexonicInheritednonsynonymous SNVNM_001204404
NM_020987
NM_001204403
c.G1397A
c.G1448A
c.G1430A
p.R466Q
p.R483Q
p.R477Q
35.0-Stessman2017 T
ANK3     AU008505chr10:
61842864-61842864
AGintronicDe novo--Yuen2017 G
ANK3     HN0112.p1chr10:
61900109-61900109
CTsplicingPaternalsplicing19.568.244E-6Guo2018 T
ANK3     T8W2Wchr10:
61843315-61843315
CTexonicUnknownnonsynonymous SNVNM_001149
NM_020987
NM_001204403
NM_001204404
c.G1537A
c.G4135A
c.G4117A
c.G4138A
p.G513R
p.G1379R
p.G1373R
p.G1380R
17.61.656E-5Stessman2017 T
ANK3     03C16650chr10:
61956298-61956299
TCATexonicUnknownnonframeshift substitutionNM_001204404
NM_020987
NM_001204403
c.1723_1724AT
c.1774_1775AT
c.1756_1757AT
N/A
N/A
N/A
--Stessman2017 T
ANK3     ASC_CA_81_Achr10:
61932078-61932078
GCexonicDe novosynonymous SNVNM_001204404
NM_020987
NM_001204403
c.C2415G
c.C2466G
c.C2448G
p.T805T
p.T822T
p.T816T
--Satterstrom2020 E
ANK3     2-1358-003chr10:
61802590-61802590
TCintronicDe novo--Yuen2017 G
ANK3     GX0258.p1chr10:
61846521-61846521
GAexonicPaternalnonsynonymous SNVNM_001149
NM_020987
NM_001204403
NM_001204404
c.C1064T
c.C3662T
c.C3644T
c.C3665T
p.P355L
p.P1221L
p.P1215L
p.P1222L
34.0-Guo2018 T
ANK3     M26870chr10:
62374958-62374958
GAexonicPaternalstopgainNM_001204403c.C82Tp.R28X37.0-Guo2018 T
Wang2016 T
ANK3     Codina-Sola2015:ASD_14chr10:
61815514-61815514
GAexonicMaternalnonsynonymous SNVNM_001149
NM_001204403
NM_001204404
NM_020987
c.C2839T
c.C5419T
c.C5440T
c.C12967T
p.P947S
p.P1807S
p.P1814S
p.P4323S
24.9-Codina-Sola2015 E
ANK3     2-1425-003chr10:
62418655-62418655
AAAGGintronicDe novo--Yuen2017 G
ANK3     2-1373-003chr10:
62019990-62019990
GAintronicDe novo--Yuen2016 G
Yuen2017 G
ANK3     AU003405chr10:
62246669-62246669
TCintronicDe novo--Yuen2017 G
ANK3     M23067chr10:
61894114-61894114
GAexonicUnknownnonsynonymous SNVNM_001149
NM_020987
NM_001204403
NM_001204404
c.C158T
c.C2756T
c.C2738T
c.C2759T
p.S53L
p.S919L
p.S913L
p.S920L
21.61.686E-5Stessman2017 T
ANK3     1-0385-003chr10:
62412851-62412851
TCintronicDe novo--Yuen2017 G
ANK3     AU2495302chr10:
62322169-62322169
GAintronicDe novo--Yuen2017 G
ANK3     AU3720302chr10:
61962985-61962985
GAintronicDe novo--Yuen2017 G
ANK3     Chen2017:15chr10:
62023648-62023648
GAexonicDe novononsynonymous SNVNM_001204404
NM_020987
NM_001204403
c.C593T
c.C644T
c.C626T
p.T198M
p.T215M
p.T209M
26.48.241E-6Chen2017 E
ANK3     SP0023444chr10:
62029959-62029959
GAexonicDe novononsynonymous SNVNM_001204404
NM_020987
NM_001204403
c.C392T
c.C443T
c.C425T
p.A131V
p.A148V
p.A142V
32.0-Feliciano2019 E
ANK3     Shi2013:2chr10:
61829571-61829571
CTexonicInheritednonsynonymous SNVNM_020987c.G11068Ap.G3690R12.53-Shi2013 G
ANK3     2-0223-003chr10:
62144730-62144751
GCCTGGATCCCCATCAGAGCTTGintronicDe novo--Yuen2017 G
ANK3     AU4093304chr10:
62097145-62097145
GAintronicDe novo--Yuen2017 G
ANK3     14016.p1chr10:
61833372-61833372
GAexonicDe novononsynonymous SNVNM_020987c.C7267Tp.R2423C18.178.26E-6Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
ANK3     11540.p1chr10:
61833827-61833827
AGexonicDe novononsynonymous SNVNM_020987c.T6812Cp.M2271T13.118.24E-6Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Sanders2012 E
Satterstrom2020 E
Wilfert2021 G
ANK3     1-0627-003chr10:
62188764-62188764
TCintronicDe novo--Yuen2017 G
ANK3     11736.p1chr10:
61967911-61967911
GAexonicDe novosynonymous SNVNM_001204404
NM_020987
NM_001204403
c.C1026T
c.C1077T
c.C1059T
p.P342P
p.P359P
p.P353P
-4.946E-5Iossifov2014 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
Wilfert2021 G
ANK3     AU3645301chr10:
62093639-62093639
CAintronicDe novo--Yuen2017 G
ANK3     2-1329-003chr10:
62164746-62164746
AGintronicDe novo--Yuen2016 G
Yuen2017 G
ANK3     2-0122-003chr10:
61934951-61934951
GCintronicDe novo--Yuen2017 G
ANK3     Codina-Sola2015:ASD_29chr10:
61829729-61829729
TCexonicPaternalnonsynonymous SNVNM_020987c.A10910Gp.H3637R16.58-Codina-Sola2015 E
ANK3     1-0285-003chr10:
62192147-62192147
GTintronicDe novo--Yuen2017 G
ANK3     M23688chr10:
61932868-61932868
GAexonicMaternalnonsynonymous SNVNM_001204404
NM_020987
NM_001204403
c.C2210T
c.C2261T
c.C2243T
p.A737V
p.A754V
p.A748V
36.09.906E-5Wang2016 T
ANK3     M15169chr10:
61955953-61955953
CGexonicMaternalnonsynonymous SNVNM_001204404
NM_020987
NM_001204403
c.G1786C
c.G1837C
c.G1819C
p.V596L
p.V613L
p.V607L
34.0-Guo2018 T
Wang2016 T
ANK3     1-0715-003chr10:
62345673-62345673
TGintronicDe novo--Yuen2017 G
ANK3     211-5571-3chr10:
61874029-61874029
CGexonicUnknownnonsynonymous SNVNM_001149
NM_020987
NM_001204403
NM_001204404
c.G304C
c.G2902C
c.G2884C
c.G2905C
p.D102H
p.D968H
p.D962H
p.D969H
29.3-Stessman2017 T
ANK3     Lim2017:68648chr10:
61967911-61967911
GAexonicDe novosynonymous SNVNM_001204404
NM_020987
NM_001204403
c.C1026T
c.C1077T
c.C1059T
p.P342P
p.P359P
p.P353P
-4.946E-5Lim2017 E
ANK3     AU056204chr10:
62350770-62350770
TCintronicDe novo--Yuen2017 G
ANK3     Lim2017:36002chr10:
61833372-61833372
GAexonicDe novononsynonymous SNVNM_020987c.C7267Tp.R2423C18.178.26E-6Lim2017 E
ANK3     Ishay2021:3chr10:
61834098-61834098
CAexonicInheritednonsynonymous SNVNM_020987c.G6541Tp.G2181W17.766.0E-4Ishay2021 E
ANK3     Ishay2021:2chr10:
61833414-61833414
AGexonicInheritednonsynonymous SNVNM_020987c.T7225Cp.S2409P18.60.0047Ishay2021 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More