or
or
Exact

Results for "GAS2"

Variant Events: 11

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
GAS2     1-0454-003chr11:
22830584-22830584
CTintronicDe novo--Yuen2016 G
Yuen2017 G
GAS2     1-0906-003chr11:
22691499-22691499
TCintronicDe novo--Yuen2017 G
GAS2     AU3646301chr11:
22715451-22715451
GAintronicDe novo--Yuen2017 G
GAS2     Codina-Sola2015:ASD_8chr11:
22747894-22747894
TGexonicMaternalnonsynonymous SNVNM_005256
NM_001143830
NM_177553
c.T324G
c.T324G
c.T324G
p.F108L
p.F108L
p.F108L
13.37-Codina-Sola2015 E
GAS2     2-1521-003chr11:
22739804-22739818
CATATATATATATATCATATATATATATintronicDe novo--Yuen2017 G
GAS2     1-0402-003chr11:
22738504-22738504
AGintronicDe novo--Yuen2017 G
GAS2     AU4069302chr11:
22700027-22700027
AGintronicDe novo--Yuen2017 G
GAS2     2-0273-003chr11:
22826888-22826888
AGintronicDe novo--Yuen2017 G
GAS2     2-1455-003chr11:
22727435-22727435
TCintronicDe novo--Yuen2016 G
Yuen2017 G
GAS2     AU3703302chr11:
22772952-22772952
TCintronicDe novo--Yuen2017 G
GAS2     AGG0019chr11:
22770828-22770828
TAintronicDe novo--Satterstrom2020 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More