or
or
Exact

Results for "KIAA0586"

Variant Events: 26

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
KIAA0586     JASD_Fam0062chr14:
58965637-58965637
GAexonicDe novononsynonymous SNVNM_001244193
NM_014749
NM_001244191
NM_001244190
NM_001244192
NM_001244189
c.G3707A
c.G3899A
c.G3872A
c.G4082A
c.G3995A
c.G4286A
p.C1236Y
p.C1300Y
p.C1291Y
p.C1361Y
p.C1332Y
p.C1429Y
7.047-Takata2018 E
KIAA0586     11348.p1chr14:
58895068-58895068
AGexonicDe novononsynonymous SNVNM_014749
NM_001244189
NM_001244190
c.A86G
c.A122G
c.A41G
p.H29R
p.H41R
p.H14R
8.19-Iossifov2014 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
Wilfert2021 G
KIAA0586     iHART1824chr14:
58923419-58923419
GCsplicingMaternalsplicing9.4477.866E-5Ruzzo2019 G
KIAA0586     iHART1618chr14:
58895075-58895075
TTCexonicMaternalframeshift insertionNM_014749
NM_001244189
NM_001244190
c.94dupC
c.130dupC
c.49dupC
p.D31fs
p.D43fs
p.D16fs
-3.0E-4Ruzzo2019 G
KIAA0586     11229.p1chr14:
58954766-58954766
GCexonicDe novononsynonymous SNVNM_001244193
NM_014749
NM_001244191
NM_001244190
NM_001244192
NM_001244189
c.G3046C
c.G3238C
c.G3211C
c.G3421C
c.G3334C
c.G3625C
p.D1016H
p.D1080H
p.D1071H
p.D1141H
p.D1112H
p.D1209H
18.42.0E-4Satterstrom2020 E
KIAA0586     2-1644-003chr14:
58937301-58937305
CAGAACintronicDe novo-1.271E-5Yuen2017 G
KIAA0586     AU060004chr14:
58921719-58921742
AATTTTTCTTCATCCATTTTTCTTAATTTTTCTTintronicDe novo--Yuen2017 G
KIAA0586     AU4444304chr14:
59055341-59055341
CTintergenicDe novo--Yuen2017 G
KIAA0586     1-0862-003chr14:
58944858-58944858
CTintronicDe novo--Yuen2017 G
KIAA0586     AU2075301chr14:
59061251-59061251
GTintergenicDe novo--Yuen2017 G
KIAA0586     AU2292302chr14:
59040907-59040907
GAintergenicDe novo--Yuen2017 G
KIAA0586     2-1731-003chr14:
59030437-59030437
CTintergenicDe novo--Yuen2017 G
KIAA0586     7-0024-005chr14:
58912877-58912877
CTintronicDe novo--Yuen2017 G
KIAA0586     2-1475-003chr14:
58915756-58915756
ACintronicDe novo--Yuen2017 G
KIAA0586     AU2029301chr14:
59076269-59076269
TCintergenicDe novo--Yuen2017 G
KIAA0586     AU2292301chr14:
59040907-59040907
GAintergenicDe novo--Yuen2017 G
KIAA0586     35849chr14:
58895068-58895068
AGexonicDe novononsynonymous SNVNM_014749
NM_001244189
NM_001244190
c.A86G
c.A122G
c.A41G
p.H29R
p.H41R
p.H14R
8.19-Fu2022 E
KIAA0586     1-0412-003chr14:
59044071-59044071
CTintergenicDe novo--Yuen2017 G
KIAA0586     AU2293301chr14:
59020837-59020837
AGintergenicDe novo--Yuen2017 G
KIAA0586     11456.p1chr14:
58951396-58951396
GCintronicDe novo--Turner2016 G
KIAA0586     Lim2017:35849chr14:
58895068-58895068
AGexonicDe novononsynonymous SNVNM_014749
NM_001244189
NM_001244190
c.A86G
c.A122G
c.A41G
p.H29R
p.H41R
p.H14R
8.19-Lim2017 E
KIAA0586     1-0065-005chr14:
58903544-58903544
AACTintronicDe novo--Yuen2017 G
KIAA0586     1-0556-003chr14:
58967579-58967579
GCintronicDe novo--Yuen2017 G
KIAA0586     AU054303chr14:
58959519-58959519
ACintronicDe novo--Yuen2017 G
KIAA0586     SP0040514chr14:
58932525-58932525
AAAATATTGTTAGintronicDe novo--Fu2022 E
KIAA0586     AU1764301chr14:
58908209-58908209
GAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More