
Results for "USH2A"

Variant Events: 61

Gene symbol on which the variant is located
Subject Identifier from the original study
Genomic location of the reference allele
Reference allele
Alternate allele
Variant functional categories
Variant validation performed by an orthogonal method and reported
Reported inheritance status
Variant effect on transcript per Annovar
Transcript used for the cDNA/Protein mutation
cDNA variant notation
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Source(s) where variants from this event are reported
USH2A     09C82560chr1:
TCintronicDe novo--Kosmicki2017 E
Satterstrom2020 E
USH2A     2-1066-004chr1:
GTintronicDe novo--Yuen2017 G
USH2A     2-1382-003chr1:
GAintronicDe novo--Yuen2017 G
USH2A     2-1306-004chr1:
GGGAGCintronicDe novo--Yuen2017 G
USH2A     1-0339-003chr1:
GAintronicDe novo--Yuen2017 G
USH2A     2-1295-003chr1:
CGintronicDe novo--Yuen2016 G
Yuen2017 G
USH2A     AU065304chr1:
TCintronicDe novo--Yuen2017 G
USH2A     AU4122301chr1:
GCintronicDe novo--Yuen2017 G
USH2A     1-0551-003chr1:
TGintronicDe novo--Yuen2017 G
USH2A     1-0675-003chr1:
CTintronicDe novo--Yuen2017 G
USH2A     Chen2021:22chr1:
GCexonicPaternalnonsynonymous SNVNM_007123
21.3-Chen2021 GET
USH2A     1-0347-003chr1:
CAintronicDe novo--Yuen2017 G
USH2A     2-1306-003chr1:
GGGAGCintronicDe novo--Yuen2017 G
USH2A     12600.p1chr1:
TCexonicDe novosynonymous SNVNM_206933c.A9273Gp.T3091T--Iossifov2014 E
Kosmicki2017 E
Krupp2017 E
Lim2017 E
Satterstrom2020 E
Wilfert2021 G
USH2A     AU3646301chr1:
GAintronicDe novo--Yuen2017 G
USH2A     11897.p1chr1:
ACexonicDe novononsynonymous SNVNM_206933c.T7643Gp.M2548R13.06-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Lim2017 E
Satterstrom2020 E
Wilfert2021 G
USH2A     09C87038chr1:
AGexonicDe novononsynonymous SNVNM_007123
12.03-DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Neale2012 E
Satterstrom2020 E
USH2A     Chen2021:22chr1:
GAexonicPaternalnonsynonymous SNVNM_206933c.C7616Tp.P2539L17.599.179E-5Chen2021 GET
USH2A     13130.p1chr1:
GAintronicDe novo--Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
USH2A     Chen2021:22chr1:
GAexonicMaternalnonsynonymous SNVNM_206933c.C10931Tp.T3644M16.887.419E-5Chen2021 GET
USH2A     7-0133-003chr1:
TAACAAAGACAGTTTCAGACTintronicDe novo--Yuen2017 G
USH2A     13641.p1chr1:
GTexonicDe novostopgainNM_206933c.C7509Ap.Y2503X51.0-Ji2016 E
USH2A     5-0088-003chr1:
CAintronicDe novo--Yuen2017 G
USH2A     AU2137304chr1:
AGintronicDe novo--Yuen2017 G
USH2A     AU4426303chr1:
CTintronicDe novo--Yuen2017 G
USH2A     AU072904chr1:
TAintronicDe novo--Yuen2017 G
USH2A     1-0405-003chr1:
CTintronicDe novo--Yuen2017 G
USH2A     2-1323-003chr1:
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
USH2A     AU3632301chr1:
GAintergenicDe novo--Yuen2017 G
USH2A     Lim2017:35873chr1:
TGexonicDe novononsynonymous SNVNM_206933c.A10042Cp.I3348L12.12-Lim2017 E
USH2A     344-05-104641chr1:
GAexonicDe novononsynonymous SNVNM_007123
24.22.477E-5Satterstrom2020 E
USH2A     1-0257-003chr1:
CTintergenicDe novo--Yuen2017 G
USH2A     2-1386-003chr1:
CTintronicDe novo--Yuen2016 G
Yuen2017 G
USH2A     2-1427-003chr1:
CAintronicDe novo--Yuen2017 G
USH2A     1-0244-003chr1:
CGintronicDe novo--Yuen2016 G
Yuen2017 G
USH2A     1-0244-003chr1:
ATintronicDe novo--Yuen2016 G
Yuen2017 G
USH2A     13171.p1chr1:
TCintronicDe novo--Turner2016 G
USH2A     11572.p1chr1:
TGexonicMosaic, De novononsynonymous SNVNM_206933c.A10042Cp.I3348L12.12-Dou2017 E
Ji2016 E
Turner2016 G
USH2A     1-0209-003chr1:
GAintronicDe novo--Yuen2017 G
USH2A     AU3861303chr1:
ATintronicDe novo--Yuen2017 G
USH2A     AU4378301chr1:
TCexonicDe novononsynonymous SNVNM_007123
9.479-Yuen2017 G
USH2A     AU3861303chr1:
GTintronicDe novo--Yuen2017 G
USH2A     AU3760301chr1:
GAintronicDe novo--Yuen2017 G
USH2A     5-0025-004chr1:
GAintronicDe novo--Yuen2017 G
USH2A     2-0214-003chr1:
CTintronicDe novo--Yuen2017 G
USH2A     iHART2091chr1:
AAATexonicMaternalframeshift insertionNM_206933c.10596_10597insATp.Y3533fs--Ruzzo2019 G
USH2A     09C96107chr1:
ACexonicstopgainNM_206933c.T12714Gp.Y4238X55.0-Doan2019 E
Doan2019 E
USH2A     1-0265-004chr1:
TAGTintronicDe novo--Yuen2017 G
USH2A     2-1605-003chr1:
CTintronicDe novo--Yuen2017 G
USH2A     2-0144-004chr1:
TCintronicDe novo--Yuen2017 G
USH2A     iHART2274chr1:
TCTexonicMaternalframeshift deletionNM_007123
-8.0E-4Ruzzo2019 G
USH2A     iHART2272chr1:
TCTexonicMaternalframeshift deletionNM_007123
-8.0E-4Ruzzo2019 G
USH2A     09C96107chr1:
CTexonicstopgainNM_206933c.G6224Ap.W2075X50.0-Doan2019 E
Doan2019 E
USH2A     2-1329-003chr1:
GAintronicDe novo--Yuen2016 G
Yuen2017 G
USH2A     1-0329-003chr1:
CGintronicDe novo--Yuen2017 G
USH2A     B0671chr1:
GAexonicMaternalnonsynonymous SNVNM_206933c.C7616Tp.P2539L17.599.179E-5Xiong2019 ET
USH2A     B0671chr1:
GAexonicMaternalnonsynonymous SNVNM_206933c.C10931Tp.T3644M16.887.419E-5Xiong2019 ET
USH2A     B0671chr1:
GCexonicPaternalnonsynonymous SNVNM_007123
21.3-Xiong2019 ET
USH2A     1-0804-003chr1:
AGintronicDe novo--Yuen2017 G
USH2A     2-0273-003chr1:
ATintronicDe novo--Yuen2017 G
USH2A     1-0052-004chr1:
ACintronicDe novo--Yuen2017 G
Source Variant Information

, -


Paper alias:

No records found.
Paper Information
Variant source
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView