or
or
Exact

Results for "NLRP3"

Variant Events: 6

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
NLRP3     AU4173301chr1:
247583800-247583800
GAintronicDe novo--Yuen2017 G
NLRP3     Lim2017:35953chr1:
247582253-247582253
GAexonicDe novononsynonymous SNVNM_001127462
NM_001243133
NM_004895
NM_183395
NM_001127461
NM_001079821
c.G157A
c.G151A
c.G157A
c.G157A
c.G157A
c.G157A
p.D53N
p.D51N
p.D53N
p.D53N
p.D53N
p.D53N
22.28.266E-6Lim2017 E
NLRP3     1-0447-003chr1:
247606532-247606551
CTTATTTATTTATTTATTTACTTATTTATTTATTTAintronicDe novo--Yuen2017 G
NLRP3     13277.p1chr1:
247582253-247582253
GAexonicDe novononsynonymous SNVNM_001127462
NM_001243133
NM_004895
NM_183395
NM_001127461
NM_001079821
c.G157A
c.G151A
c.G157A
c.G157A
c.G157A
c.G157A
p.D53N
p.D51N
p.D53N
p.D53N
p.D53N
p.D53N
22.28.266E-6Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
NLRP3     AU2863302chr1:
247607574-247607574
CTintronicDe novo--Yuen2017 G
NLRP3     14143.p1chr1:
247611853-247611853
GCUTR3De novo--Satterstrom2020 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More