
Results for "ARHGAP32"

Variant Events: 80

Gene symbol on which the variant is located
Subject Identifier from the original study
Genomic location of the reference allele
Reference allele
Alternate allele
Variant functional categories
Variant validation performed by an orthogonal method and reported
Reported inheritance status
Variant effect on transcript per Annovar
Transcript used for the cDNA/Protein mutation
cDNA variant notation
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Source(s) where variants from this event are reported
ARHGAP32     7-0242-003chr11:
GAintronicDe novo--Trost2022 G
Yuen2017 G
ARHGAP32     M20730chr11:
GAexonicUnknownnonsynonymous SNVNM_014715
14.038.975E-6Wang2016 T
ARHGAP32     AU004017chr11:
GAexonicDe novononsynonymous SNVNM_014715
20.48.237E-6DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
ARHGAP32     220-9976-203chr11:
GAexonicMaternalstopgainNM_001142685c.C73Tp.Q25X25.7-Stessman2017 T
ARHGAP32     2-1426-003chr11:
TGintronicDe novo--Trost2022 G
Yuen2017 G
ARHGAP32     SP0068785chr11:
GAexonicDe novononsynonymous SNVNM_014715
20.7-Antaki2022 GE
Fu2022 E
Trost2022 G
Zhou2022 GE
ARHGAP32     M16079chr11:
GCexonicMaternalnonsynonymous SNVNM_014715
15.316.595E-5Wang2016 T
ARHGAP32     M15093chr11:
CGexonicMaternalnonsynonymous SNVNM_014715
12.8-Wang2016 T
ARHGAP32     M32041chr11:
TTAexonicMaternalframeshift insertionNM_014715
--Guo2018 T
ARHGAP32     SP0111761chr11:
AGexonicDe novosynonymous SNVNM_014715
--Fu2022 E
Trost2022 G
Zhou2022 GE
ARHGAP32     AU3702307chr11:
GAintronicDe novo--Trost2022 G
Yuen2017 G
ARHGAP32     SP0172698chr11:
GGTexonicDe novoframeshift insertionNM_001142685c.1030dupAp.T344fs--Trost2022 G
ARHGAP32     AU2320301chr11:
ATAintronicDe novo--Trost2022 G
ARHGAP32     M12374chr11:
CTexonicPaternalnonsynonymous SNVNM_014715
0.003-Wang2016 T
ARHGAP32     MSSNG00120-003chr11:
AGintronicDe novo--Trost2022 G
ARHGAP32     AU2320301chr11:
GCintronicDe novo--Trost2022 G
ARHGAP32     1-1165-003chr11:
GCUTR3De novo--Trost2022 G
ARHGAP32     1-0654-003chr11:
GAintronicDe novo--Trost2022 G
ARHGAP32     3-0246-000chr11:
GTintergenicDe novo--Yuen2017 G
ARHGAP32     MSSNG00353-003chr11:
GGAintronicDe novo--Trost2022 G
ARHGAP32     REACH000001chr11:
ACintronicDe novo--Trost2022 G
ARHGAP32     7-0309-003chr11:
GAintronicDe novo--Trost2022 G
ARHGAP32     2-0103-004chr11:
GATTAGintronicDe novo--Trost2022 G
ARHGAP32     3-0752-000chr11:
GAintronicDe novo--Trost2022 G
ARHGAP32     3-0325-000chr11:
AGintronicDe novo--Trost2022 G
ARHGAP32     3-0208-000chr11:
CTintronicDe novo--Trost2022 G
ARHGAP32     216-4484-1chr11:
GAexonicUnknownnonsynonymous SNVNM_014715
19.03.557E-5Stessman2017 T
ARHGAP32     MSSNG00217-003chr11:
GAintronicDe novo--Trost2022 G
ARHGAP32     M23710chr11:
GTexonicMaternalnonsynonymous SNVNM_014715
13.85-Wang2016 T
ARHGAP32     1-0271-004chr11:
TAintronicDe novo--Trost2022 G
ARHGAP32     1-0092-004chr11:
AACTAGAintronicDe novo--Trost2022 G
ARHGAP32     1-0611-005chr11:
CTintronicDe novo--Trost2022 G
ARHGAP32     3-0645-000chr11:
GAintronicDe novo--Trost2022 G
ARHGAP32     5-5163-003chr11:
GAintronicDe novo--Trost2022 G
ARHGAP32     2-0159-003chr11:
AGTTAintronicDe novo--Trost2022 G
ARHGAP32     SJD_55.3chr11:
AGintronicDe novo--Trost2022 G
ARHGAP32     217-14051-880chr11:
CTexonicUnknownnonsynonymous SNVNM_014715
26.28.237E-6Stessman2017 T
ARHGAP32     1-0458-004chr11:
CTintronicDe novo--Trost2022 G
Yuen2017 G
ARHGAP32     3-0072-000chr11:
TCintronicDe novo--Trost2022 G
ARHGAP32     M11423chr11:
CGexonicPaternalnonsynonymous SNVNM_014715
15.83-Wang2016 T
ARHGAP32     1-0551-004chr11:
CTintergenicDe novo--Yuen2017 G
ARHGAP32     1-0092-004chr11:
CTACTintronicDe novo--Trost2022 G
ARHGAP32     7-0023-003chr11:
TCintronicDe novo--Trost2022 G
Yuen2017 G
ARHGAP32     2-0014-003chr11:
GGTGTATintronicDe novo--Trost2022 G
ARHGAP32     A5chr11:
CTintergenicDe novo--Wu2018 G
ARHGAP32     M23136chr11:
CTexonicMaternalnonsynonymous SNVNM_014715
19.782.0E-4Wang2016 T
ARHGAP32     AU4487302chr11:
ACintronicDe novo--Trost2022 G
Yuen2017 G
ARHGAP32     M20600chr11:
TCexonicMaternalnonsynonymous SNVNM_014715
12.52-Wang2016 T
ARHGAP32     DEASD_1016_001chr11:
ACexonicDe novononsynonymous SNVNM_014715
16.41-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
ARHGAP32     M20606chr11:
TCexonicMaternalnonsynonymous SNVNM_014715
22.21.648E-5Wang2016 T
ARHGAP32     1-0273-004chr11:
GAintergenicDe novo--Yuen2017 G
ARHGAP32     1-0706-003chr11:
AGintronicDe novo--Trost2022 G
Yuen2017 G
ARHGAP32     M17574chr11:
TCexonicMaternalnonsynonymous SNVNM_014715
11.849.061E-5Wang2016 T
ARHGAP32     M13398chr11:
TCexonicMaternalnonsynonymous SNVNM_014715
19.818.282E-6Wang2016 T
ARHGAP32     1-0367-003chr11:
CTintronicDe novo--Yuen2017 G
ARHGAP32     M21636chr11:
TCexonicMaternalnonsynonymous SNVNM_001142685c.A454Gp.K152E15.72-Wang2016 T
ARHGAP32     M17585chr11:
CTexonicMaternalnonsynonymous SNVNM_014715
6.486-Wang2016 T
ARHGAP32     M8428chr11:
CTexonicMaternalnonsynonymous SNVNM_014715
14.637.465E-5Wang2016 T
ARHGAP32     2-1633-003chr11:
ACintergenicDe novo--Yuen2017 G
ARHGAP32     M21681chr11:
CTexonicMaternalnonsynonymous SNVNM_001142685c.G20Ap.S7N10.02-Wang2016 T
ARHGAP32     M20247chr11:
CGCexonicDe novo, Unknownframeshift deletionNM_014715
--Guo2018 T
Stessman2017 T
Wang2016 T
ARHGAP32     2-1461-003chr11:
GAintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
ARHGAP32     M18428chr11:
CAexonicMaternalnonsynonymous SNVNM_014715
24.9-Wang2016 T
ARHGAP32     M8322chr11:
GAexonicPaternalnonsynonymous SNVNM_014715
9.236-Wang2016 T
ARHGAP32     M12390chr11:
GAexonicPaternalnonsynonymous SNVNM_001142685c.C677Tp.A226V14.72-Wang2016 T
ARHGAP32     217-14372-4850chr11:
GGGAGTAAAGTACTTCGGAAAGexonicInheritedframeshift substitutionNM_001142685c.323_324TTTCCGAAGTACTTTACTN/A--Stessman2017 T
ARHGAP32     210-18163-302chr11:
CTexonicUnknownnonsynonymous SNVNM_014715
26.81.647E-5Stessman2017 T
ARHGAP32     AU1339302chr11:
CTexonicUnknownnonsynonymous SNVNM_014715
21.22.471E-5Stessman2017 T
ARHGAP32     M20592chr11:
TCexonicUnknownnonsynonymous SNVNM_014715
0.016-Wang2016 T
ARHGAP32     1-0636-003chr11:
TCintergenicDe novo--Yuen2017 G
ARHGAP32     2-1741-003chr11:
GAintergenicDe novo--Yuen2017 G
ARHGAP32     M13338chr11:
ATexonicMaternalnonsynonymous SNVNM_014715
12.81-Wang2016 T
ARHGAP32     M15024chr11:
ACexonicPaternalnonsynonymous SNVNM_014715
7.4174.975E-5Wang2016 T
ARHGAP32     M8856chr11:
TCexonicUnknownnonsynonymous SNVNM_014715
11.22-Wang2016 T
ARHGAP32     AU1699302chr11:
GAexonicUnknownnonsynonymous SNVNM_014715
25.41.648E-5Stessman2017 T
ARHGAP32     1-0482-003chr11:
TCintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
ARHGAP32     1-0065-005chr11:
GGACintronicDe novo--Yuen2017 G
ARHGAP32     1-0354-003chr11:
GAintronicDe novo--Trost2022 G
Yuen2017 G
ARHGAP32     M10126chr11:
GAexonicMaternalnonsynonymous SNVNM_014715
19.498.238E-6Wang2016 T
ARHGAP32     5-0015-004chr11:
AGintronicDe novo--Trost2022 G
Yuen2017 G
Source Variant Information

, -


Paper alias:

No records found.
Paper Information
Variant source
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView