or
or
Exact

Results for "RAP1GAP"

Variant Events: 9

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
RAP1GAP     DEASD_0277_001chr1:
21929359-21929359
CTexonicDe novosynonymous SNVNM_001145658
NM_002885
NM_001145657
c.G1668A
c.G1476A
c.G1554A
p.P556P
p.P492P
p.P518P
--DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
RAP1GAP     2-1454-003chr1:
21981878-21981891
GACACACACACACAGACACACACACAintronicDe novo--Yuen2017 G
RAP1GAP     AU4092302chr1:
21937822-21937822
CTintronicDe novo--Yuen2017 G
RAP1GAP     A1chr1:
21936419-21936419
AGintronicDe novo--Wu2018 G
RAP1GAP     1-0045-004chr1:
21940343-21940343
AGintronicDe novo--Yuen2017 G
RAP1GAP     AU3782302chr1:
21993317-21993317
TCintronicDe novo--Yuen2017 G
RAP1GAP     AU3951302chr1:
21946033-21946033
GAintronicDe novo--Yuen2017 G
RAP1GAP     SP0008060chr1:
21945531-21945531
GAexonicDe novononsynonymous SNVNM_001145658
NM_002885
NM_001145657
c.C245T
c.C53T
c.C53T
p.P82L
p.P18L
p.P18L
23.21.775E-5Fu2022 E
RAP1GAP     AU066404chr1:
21986343-21986343
ATintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More