or
or
Exact

Results for "ARHGAP32"

Variant Events: 54

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ARHGAP32     7-0242-003chr11:
128898221-128898221
GAintronicDe novo--Yuen2017 G
ARHGAP32     M20730chr11:
128842449-128842449
GAexonicUnknownnonsynonymous SNVNM_014715
NM_001142685
c.C2863T
c.C3910T
p.R955C
p.R1304C
14.038.975E-6Wang2016 T
ARHGAP32     AU004017chr11:
128839782-128839782
GAexonicDe novononsynonymous SNVNM_014715
NM_001142685
c.C4237T
c.C5284T
p.R1413W
p.R1762W
20.48.237E-6DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
ARHGAP32     220-9976-203chr11:
129062021-129062021
GAexonicMaternalstopgainNM_001142685c.C73Tp.Q25X25.7-Stessman2017 T
ARHGAP32     2-1426-003chr11:
129028094-129028094
TGintronicDe novo--Yuen2017 G
ARHGAP32     M16079chr11:
128844790-128844790
GCexonicMaternalnonsynonymous SNVNM_014715
NM_001142685
c.C1213G
c.C2260G
p.L405V
p.L754V
15.316.595E-5Wang2016 T
ARHGAP32     M15093chr11:
128840441-128840441
CGexonicMaternalnonsynonymous SNVNM_014715
NM_001142685
c.G3578C
c.G4625C
p.R1193T
p.R1542T
12.8-Wang2016 T
ARHGAP32     M32041chr11:
128839261-128839261
TTAexonicMaternalframeshift insertionNM_014715
NM_001142685
c.4757dupT
c.5804dupT
p.L1586fs
p.L1935fs
--Guo2018 T
ARHGAP32     AU3702307chr11:
128916692-128916692
GAintronicDe novo--Yuen2017 G
ARHGAP32     M12374chr11:
128844223-128844223
CTexonicPaternalnonsynonymous SNVNM_014715
NM_001142685
c.G1780A
c.G2827A
p.V594I
p.V943I
0.003-Wang2016 T
ARHGAP32     3-0246-000chr11:
129214047-129214047
GTintergenicDe novo--Yuen2017 G
ARHGAP32     216-4484-1chr11:
128842467-128842467
GAexonicUnknownnonsynonymous SNVNM_014715
NM_001142685
c.C2845T
c.C3892T
p.R949C
p.R1298C
19.03.557E-5Stessman2017 T
ARHGAP32     M23710chr11:
128838917-128838917
GTexonicMaternalnonsynonymous SNVNM_014715
NM_001142685
c.C5102A
c.C6149A
p.P1701H
p.P2050H
13.85-Wang2016 T
ARHGAP32     217-14051-880chr11:
128840405-128840405
CTexonicUnknownnonsynonymous SNVNM_014715
NM_001142685
c.G3614A
c.G4661A
p.R1205Q
p.R1554Q
26.28.237E-6Stessman2017 T
ARHGAP32     1-0458-004chr11:
128979299-128979299
CTintronicDe novo--Yuen2017 G
ARHGAP32     M11423chr11:
128844392-128844392
CGexonicPaternalnonsynonymous SNVNM_014715
NM_001142685
c.G1611C
c.G2658C
p.K537N
p.K886N
15.83-Wang2016 T
ARHGAP32     1-0551-004chr11:
129183912-129183912
CTintergenicDe novo--Yuen2017 G
ARHGAP32     7-0023-003chr11:
129017384-129017384
TCintronicDe novo--Yuen2017 G
ARHGAP32     A5chr11:
129138289-129138289
CTintergenicDe novo--Wu2018 G
ARHGAP32     M23136chr11:
128842466-128842466
CTexonicMaternalnonsynonymous SNVNM_014715
NM_001142685
c.G2846A
c.G3893A
p.R949H
p.R1298H
19.782.0E-4Wang2016 T
ARHGAP32     AU4487302chr11:
128962448-128962448
ACintronicDe novo--Yuen2017 G
ARHGAP32     M20600chr11:
128842712-128842712
TCexonicMaternalnonsynonymous SNVNM_014715
NM_001142685
c.A2600G
c.A3647G
p.Y867C
p.Y1216C
12.52-Wang2016 T
ARHGAP32     DEASD_1016_001chr11:
128840384-128840384
ACexonicDe novononsynonymous SNVNM_014715
NM_001142685
c.T3635G
c.T4682G
p.L1212W
p.L1561W
16.41-Satterstrom2020 E
ARHGAP32     M20606chr11:
128839494-128839494
TCexonicMaternalnonsynonymous SNVNM_014715
NM_001142685
c.A4525G
c.A5572G
p.K1509E
p.K1858E
22.21.648E-5Wang2016 T
ARHGAP32     1-0273-004chr11:
129199187-129199187
GAintergenicDe novo--Yuen2017 G
ARHGAP32     1-0706-003chr11:
128867315-128867315
AGintronicDe novo--Yuen2017 G
ARHGAP32     M17574chr11:
128840289-128840289
TCexonicMaternalnonsynonymous SNVNM_014715
NM_001142685
c.A3730G
c.A4777G
p.M1244V
p.M1593V
11.849.061E-5Wang2016 T
ARHGAP32     M13398chr11:
128848770-128848770
TCexonicMaternalnonsynonymous SNVNM_014715
NM_001142685
c.A928G
c.A1975G
p.S310G
p.S659G
19.818.282E-6Wang2016 T
ARHGAP32     1-0367-003chr11:
128970371-128970371
CTintronicDe novo--Yuen2017 G
ARHGAP32     M21636chr11:
128963551-128963551
TCexonicMaternalnonsynonymous SNVNM_001142685c.A454Gp.K152E15.72-Wang2016 T
ARHGAP32     M17585chr11:
128842787-128842787
CTexonicMaternalnonsynonymous SNVNM_014715
NM_001142685
c.G2525A
c.G3572A
p.S842N
p.S1191N
6.486-Wang2016 T
ARHGAP32     M8428chr11:
128843295-128843295
CTexonicMaternalnonsynonymous SNVNM_014715
NM_001142685
c.G2017A
c.G3064A
p.V673I
p.V1022I
14.637.465E-5Wang2016 T
ARHGAP32     2-1633-003chr11:
129132618-129132618
ACintergenicDe novo--Yuen2017 G
ARHGAP32     M21681chr11:
129062074-129062074
CTexonicMaternalnonsynonymous SNVNM_001142685c.G20Ap.S7N10.02-Wang2016 T
ARHGAP32     M20247chr11:
128840352-128840353
CGCexonicUnknown, De novoframeshift deletionNM_014715
NM_001142685
c.3666delC
c.4713delC
p.P1222fs
p.P1571fs
--Guo2018 T
Stessman2017 T
Wang2016 T
ARHGAP32     2-1461-003chr11:
128905671-128905671
GAintronicDe novo--Yuen2016 G
Yuen2017 G
ARHGAP32     M18428chr11:
128843237-128843237
CAexonicMaternalnonsynonymous SNVNM_014715
NM_001142685
c.G2075T
c.G3122T
p.R692L
p.R1041L
24.9-Wang2016 T
ARHGAP32     M8322chr11:
128840540-128840540
GAexonicPaternalnonsynonymous SNVNM_014715
NM_001142685
c.C3479T
c.C4526T
p.P1160L
p.P1509L
9.236-Wang2016 T
ARHGAP32     M12390chr11:
128934779-128934779
GAexonicPaternalnonsynonymous SNVNM_001142685c.C677Tp.A226V14.72-Wang2016 T
ARHGAP32     217-14372-4850chr11:
128993419-128993421
GGGAGTAAAGTACTTCGGAAAGexonicInheritedframeshift substitutionNM_001142685c.323_324TTTCCGAAGTACTTTACTN/A--Stessman2017 T
ARHGAP32     210-18163-302chr11:
128839787-128839787
CTexonicUnknownnonsynonymous SNVNM_014715
NM_001142685
c.G4232A
c.G5279A
p.R1411H
p.R1760H
26.81.647E-5Stessman2017 T
ARHGAP32     AU1339302chr11:
128839688-128839688
CTexonicUnknownnonsynonymous SNVNM_014715
NM_001142685
c.G4331A
c.G5378A
p.R1444H
p.R1793H
21.22.471E-5Stessman2017 T
ARHGAP32     M20592chr11:
128840364-128840364
TCexonicUnknownnonsynonymous SNVNM_014715
NM_001142685
c.A3655G
c.A4702G
p.T1219A
p.T1568A
0.016-Wang2016 T
ARHGAP32     1-0636-003chr11:
129223601-129223601
TCintergenicDe novo--Yuen2017 G
ARHGAP32     2-1741-003chr11:
129187619-129187619
GAintergenicDe novo--Yuen2017 G
ARHGAP32     M13338chr11:
128843026-128843026
ATexonicMaternalnonsynonymous SNVNM_014715
NM_001142685
c.T2286A
c.T3333A
p.N762K
p.N1111K
12.81-Wang2016 T
ARHGAP32     M15024chr11:
128851803-128851803
ACexonicPaternalnonsynonymous SNVNM_014715
NM_001142685
c.T466G
c.T1513G
p.S156A
p.S505A
7.4174.975E-5Wang2016 T
ARHGAP32     M8856chr11:
128840423-128840423
TCexonicUnknownnonsynonymous SNVNM_014715
NM_001142685
c.A3596G
c.A4643G
p.H1199R
p.H1548R
11.22-Wang2016 T
ARHGAP32     AU1699302chr11:
128846506-128846506
GAexonicUnknownnonsynonymous SNVNM_014715
NM_001142685
c.C1057T
c.C2104T
p.R353C
p.R702C
25.41.648E-5Stessman2017 T
ARHGAP32     1-0482-003chr11:
128847299-128847299
TCintronicDe novo--Yuen2016 G
Yuen2017 G
ARHGAP32     1-0065-005chr11:
129054884-129054884
GGACintronicDe novo--Yuen2017 G
ARHGAP32     1-0354-003chr11:
128948678-128948678
GAintronicDe novo--Yuen2017 G
ARHGAP32     M10126chr11:
128840225-128840225
GAexonicMaternalnonsynonymous SNVNM_014715
NM_001142685
c.C3794T
c.C4841T
p.P1265L
p.P1614L
19.498.238E-6Wang2016 T
ARHGAP32     5-0015-004chr11:
129060125-129060125
AGintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More