or
or
Exact

Results for "DLGAP1"

Variant Events: 82

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
DLGAP1     1-0121-003chr18:
4331404-4331404
CTintronicDe novo--Yuen2017 G
DLGAP1     1-0065-005chr18:
3618947-3618947
AACintronicDe novo--Yuen2017 G
DLGAP1     1-0841-003chr18:
4090227-4090227
AGintronicDe novo--Yuen2017 G
DLGAP1     7-0097-003chr18:
5088438-5088438
GAintergenicDe novo--Yuen2017 G
DLGAP1     1-0203-003chr18:
5027931-5027931
CTintergenicDe novo--Yuen2017 G
DLGAP1     2-1408-003chr18:
4253399-4253399
AGintronicDe novo--Yuen2017 G
DLGAP1     AU054303chr18:
4769635-4769635
CTintergenicDe novo--Yuen2017 G
DLGAP1     03C14737chr18:
3879854-3879854
CTexonicDe novononsynonymous SNVNM_001242761
NM_004746
c.G215A
c.G215A
p.R72H
p.R72H
32.0-Stessman2017 T
DLGAP1     1-0324-003chr18:
4359830-4359830
ACintronicDe novo--Yuen2017 G
DLGAP1     AU045010chr18:
3912632-3912632
TAintronicDe novo--Yuen2017 G
DLGAP1     1-0303-004chr18:
3839608-3839608
GAintronicDe novo--Yuen2017 G
DLGAP1     1-0560-003chr18:
3583340-3583354
TTCTCTCTCTCTCTCTTCTCTCTCTCTCintronicDe novo--Yuen2017 G
DLGAP1     3-0246-000chr18:
3677820-3677820
GAintronicDe novo--Yuen2016 G
Yuen2017 G
DLGAP1     1-0569-003chr18:
4251766-4251766
CTintronicDe novo--Yuen2017 G
DLGAP1     2J788chr18:
3502489-3502489
AGsplicing;exonicDe novononsynonymous SNVNM_001242765
NM_001242761
c.T1820C
c.T2726C
p.V607A
p.V909A
13.38-Satterstrom2020 E
DLGAP1     AU3716302chr18:
4207054-4207054
AGintronicDe novo--Yuen2017 G
DLGAP1     11414.p1chr18:
4171942-4171942
AGintronicDe novo--Wilfert2021 G
DLGAP1     2-1428-003chr18:
4793331-4793344
GACACACACACACAGACACACACACAintergenicDe novo--Yuen2017 G
DLGAP1     A2chr18:
4416624-4416624
TAintronicDe novo--Wu2018 G
DLGAP1     AU072504chr18:
4063127-4063127
CAintronicDe novo--Yuen2017 G
DLGAP1     AU1635302chr18:
4668222-4668222
GAintergenicDe novo--Yuen2017 G
DLGAP1     AU2793302chr18:
3810214-3810214
TCintronicDe novo--Yuen2017 G
DLGAP1     AU3874302chr18:
5091689-5091689
CTintergenicDe novo--Yuen2017 G
DLGAP1     5-0148-003chr18:
3601079-3601079
GTintronicDe novo--Yuen2017 G
DLGAP1     2-1357-003chr18:
3772125-3772125
TTCTCintronicDe novo--Yuen2017 G
DLGAP1     14022.p1chr18:
4670218-4670218
CGintergenicDe novo--Werling2018 G
DLGAP1     03C16095chr18:
3499254-3499254
GCexonicUnknownnonsynonymous SNVNM_001003809
NM_001242762
NM_001242764
NM_001242763
NM_001242766
NM_001308390
NM_004746
c.C1957G
c.C1915G
c.C1981G
c.C2029G
c.C1987G
c.C2011G
c.C2863G
p.R653G
p.R639G
p.R661G
p.R677G
p.R663G
p.R671G
p.R955G
23.7-Stessman2017 T
DLGAP1     GX0365.p1chr18:
3879776-3879776
CTexonicMaternalnonsynonymous SNVNM_001242761
NM_004746
c.G293A
c.G293A
p.R98H
p.R98H
32.01.685E-5Guo2018 T
DLGAP1     AU024607chr18:
3842953-3842953
CTintronicDe novo--Yuen2017 G
DLGAP1     2-1120-003chr18:
4335194-4335194
AGintronicDe novo--Yuen2017 G
DLGAP1     AU1698302chr18:
4410544-4410544
TCintronicDe novo--Yuen2017 G
DLGAP1     AU3888302chr18:
3611586-3611586
GAintronicDe novo--Yuen2017 G
DLGAP1     2-0102-004chr18:
4069346-4069347
ATAintronicDe novo--Yuen2017 G
DLGAP1     2-0102-004chr18:
4024765-4024765
GGTCTintronicDe novo--Yuen2017 G
DLGAP1     5-0077-003chr18:
3671529-3671540
GTTTTCCTGCTTGintronicDe novo--Yuen2017 G
DLGAP1     AU035604chr18:
3499254-3499254
GCexonicUnknownnonsynonymous SNVNM_001003809
NM_001242762
NM_001242764
NM_001242763
NM_001242766
NM_001308390
NM_004746
c.C1957G
c.C1915G
c.C1981G
c.C2029G
c.C1987G
c.C2011G
c.C2863G
p.R653G
p.R639G
p.R661G
p.R677G
p.R663G
p.R671G
p.R955G
23.7-Stessman2017 T
DLGAP1     1-0092-004chr18:
3787645-3787645
CCTintronicDe novo--Yuen2017 G
DLGAP1     1-0218-004chr18:
3618665-3618665
GGGGGTintronicDe novo--Yuen2017 G
DLGAP1     7-0044-003chr18:
3961168-3961170
CCTCCTTCTintronicDe novo--Yuen2017 G
DLGAP1     2-0116-005chr18:
5132766-5132766
GAintergenicDe novo3.241-Yuen2017 G
DLGAP1     3-0080-000chr18:
4161513-4161513
TCintronicDe novo--Yuen2016 G
Yuen2017 G
DLGAP1     AU3849303chr18:
4026862-4026862
TCintronicDe novo--Yuen2017 G
DLGAP1     14015.p1chr18:
3540760-3540760
CTintronicDe novo--Turner2016 G
DLGAP1     7-0143-003chr18:
5084154-5084154
TAintergenicDe novo--Yuen2017 G
DLGAP1     M18342chr18:
3729240-3729240
GAexonicUnknownnonsynonymous SNVNM_001003809
NM_001242762
NM_001242763
NM_001242764
NM_001242765
NM_001242766
NM_001308390
NM_001242761
NM_004746
c.C580T
c.C622T
c.C622T
c.C604T
c.C580T
c.C580T
c.C604T
c.C1486T
c.C1486T
p.R194W
p.R208W
p.R208W
p.R202W
p.R194W
p.R194W
p.R202W
p.R496W
p.R496W
22.0-Stessman2017 T
DLGAP1     14496.p1chr18:
3614330-3614330
CTintronicDe novo--Turner2016 G
DLGAP1     2-0320-003chr18:
4593585-4593585
TCintergenicDe novo--Yuen2017 G
DLGAP1     13393.p1chr18:
4498347-4498347
CTintergenicDe novo--Turner2016 G
DLGAP1     1-0138-004chr18:
4636397-4636397
GCintergenicDe novo--Yuen2017 G
DLGAP1     2-1322-004chr18:
3695175-3695175
ACintronicDe novo--Yuen2017 G
DLGAP1     1-0104-003chr18:
3517720-3517720
CGintronicDe novo--Yuen2017 G
DLGAP1     Y7H4Lchr18:
3534477-3534477
GAexonicUnknownnonsynonymous SNVNM_001003809
NM_001242762
NM_001242764
NM_001242765
NM_001242763
NM_001242766
NM_001308390
NM_001242761
NM_004746
c.C1288T
c.C1246T
c.C1312T
c.C1288T
c.C1360T
c.C1318T
c.C1342T
c.C2194T
c.C2194T
p.R430C
p.R416C
p.R438C
p.R430C
p.R454C
p.R440C
p.R448C
p.R732C
p.R732C
19.298.241E-6Stessman2017 T
DLGAP1     SP0000238chr18:
3879457-3879457
CTexonicDe novosynonymous SNVNM_001242761
NM_004746
c.G612A
c.G612A
p.S204S
p.S204S
-8.394E-6Feliciano2019 E
DLGAP1     7-0167-003chr18:
3578836-3578836
TCintronicDe novo--Yuen2017 G
DLGAP1     M20647chr18:
3879576-3879576
CTexonicUnknownnonsynonymous SNVNM_001242761
NM_004746
c.G493A
c.G493A
p.G165R
p.G165R
23.9-Stessman2017 T
DLGAP1     M12526chr18:
3879645-3879645
CAexonicUnknownnonsynonymous SNVNM_001242761
NM_004746
c.G424T
c.G424T
p.V142L
p.V142L
31.0-Guo2018 T
Wang2016 T
DLGAP1     03C19911chr18:
3874153-3874153
CTsplicingInheritedsplicing15.7-Stessman2017 T
DLGAP1     AU4024303chr18:
3738180-3738180
GAintronicDe novo--Yuen2017 G
DLGAP1     AU1078301chr18:
3874153-3874153
CTsplicingInheritedsplicing15.7-Stessman2017 T
DLGAP1     2-1306-004chr18:
4088901-4088901
AATGintronicDe novo--Yuen2017 G
DLGAP1     5-0030-003chr18:
4945118-4945118
CTintergenicDe novo--Yuen2017 G
DLGAP1     2-1302-003chr18:
5066903-5066903
GAintergenicDe novo--Yuen2017 G
DLGAP1     1-0936-003chr18:
4914769-4914769
GTintergenicDe novo--Yuen2017 G
DLGAP1     AU027506chr18:
4754095-4754095
ACintergenicDe novo--Yuen2017 G
DLGAP1     AU059903chr18:
4067370-4067395
GAGGAAGGAAGGAAGGAAGGAAGGAAGAGGAAGGAAGGAAGGAAGGAAintronicDe novo--Yuen2017 G
DLGAP1     2-0318-004chr18:
3706411-3706411
CTintronicDe novo--Yuen2017 G
DLGAP1     7-0133-003chr18:
3618665-3618665
GGGGGTintronicDe novo--Yuen2017 G
DLGAP1     2-1422-003chr18:
4359943-4359943
AGintronicDe novo--Yuen2016 G
Yuen2017 G
DLGAP1     1-0482-003chr18:
4890977-4890977
GCintergenicDe novo--Yuen2017 G
DLGAP1     1-0862-003chr18:
3636793-3636793
CGintronicDe novo--Yuen2017 G
DLGAP1     AU057404chr18:
4873190-4873190
CAintergenicDe novo--Yuen2017 G
DLGAP1     AU3637301chr18:
4343176-4343176
AGintronicDe novo--Yuen2017 G
DLGAP1     1-0162-004chr18:
4296888-4296888
GAintronicDe novo--Yuen2017 G
DLGAP1     AU2137304chr18:
3859395-3859395
TCintronicDe novo--Yuen2017 G
DLGAP1     AU058105chr18:
4458780-4458780
TCintergenicDe novo--Yuen2017 G
DLGAP1     7-0077-003chr18:
3660108-3660111
ATTTATTTTintronicDe novo--Yuen2017 G
DLGAP1     7-0077-003chr18:
4917829-4917829
CTintergenicDe novo--Yuen2017 G
DLGAP1     2-0299-005chr18:
3618947-3618947
AACAAACAAGCAAAAAACAAACAAACintronicDe novo--Yuen2017 G
DLGAP1     2-1230-003chr18:
4232203-4232203
GCintronicDe novo--Yuen2016 G
Yuen2017 G
DLGAP1     AU3808304chr18:
3497653-3497653
GAUTR3De novo--Yuen2017 G
DLGAP1     1-0032-003chr18:
3618943-3618943
AACAAAACAAACAAGCintronicDe novo--Yuen2017 G
DLGAP1     211-5649-3chr18:
4151179-4151179
CAsplicingPaternalsplicing--Stessman2017 T
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More